Улитки ахатина косметическая слизь: Улитка ахатин в косметологии, что скрывают косметологи

Содержание

Ах – ахатины! | zviazda.by

«Я ль на свете всех милее?..» Всё чаще с возрастом женщины задают себе этот вопрос, глядясь в зеркало. И чтобы получить утвердительный ответ, прикладывают неимоверные каждодневные усилия. На помощь в поддержании красоты и здоровья приходят десятки брендов косметики. Многие чудодейственные средства женщина творит сама из подаренных природой ингредиентов: травы, фрукты, ягоды, овощи, молочные продукты, экстракты животных жиров. В последнее время на пике популярности оказались косметические препараты, имеющие в своём составе такой уникальный компонент, как муцин улитки.  


Косметику сопровождают сотни восторженных отзывов. Крема с муцином интенсивно увлажняют кожу, придавая ей здоровый и свежий вид, делая упругой и эластичной. Они гипоаллергенны, поэтому идеально подходят и для чувствительной кожи. Спектр их применения неимоверно широк: сухая и жирная кожа, микроповреждения, акне и постакне, веснушки и пигментные пятна, неглубокие морщины, а также растяжки и целлюлит.

Ну, разве ж это не настоящее чудо!

Спасибо французской кухне 

У каждого волшебного средства должна быть своя легенда. История крайне популярной сегодня косметики с муцином началась с… французской кухни.

В принципе, люди питались улитками ещё в доисторические времена и везде, где только могли их добыть. При археологических раскопках в кострищах на стоянках древнего человека повсюду находят обугленные раковины. Разводить же виноградных улиток начали древние римляне: они создали специальные «улиточные сады», где откармливали улиток, взятых у природы, ароматными травами, особенно тимьяном. В своих трудах Плиний Старший утверждал, что мясо улиток особенно полезно при заболеваниях желудка и опорно-двигательной системы.

Из Древнего Рима культура употребления улиток в пищу распространилась на Францию, Англию, Германию. Монахи в Средневековье выращивали улиток на капустных грядках: католическая церковь не запрещала есть улиток и во время постов.

Известно, что для здоровья полезные свойства этих брюхоногих моллюсков использовали прежде всего древние греки. Гиппократ применял мазь на основе секрета улитки при ожогах, различных воспалениях и раздражении кожи. Есть описания, что больным коклюшем в качестве лекарства давали кусочек сахара, пропитанный слизью улитки. А женщины-гречанки просто клали улиток на лицо, таким образом увлажняя кожу.

На фермах Южной Америки много лет как выращивают улиток для поставок в рестораны. Именно французское блюдо эскарго – знаменитый деликатес из моллюсков – стало поводом, который  привлёк внимание к улиткам с точки зрения косметологии. В 1980-х годах некто Фернандо Баскуньян, крупный владелец чилийской улиточной фермы, обратил внимание на то, что кожа на руках работниц, собиравших улиток для французских ресторанов, выглядела удивительно молодой и гладкой, несмотря на агрессивное южное солнце. Мелкие царапины, мозоли и ожоги чудесным образом быстро заживали, не оставляя следов. Это наблюдение стало настоящим открытием не только для Баскуньяна, но и для мировой косметической отрасли. Так возникла идея превратить улиточную ферму в косметический бизнес (производство улиток очень дешёвое, технологически несложное).

Началось активное изучение состава и свойств улиточного муцина. Исследования и составление формулы заняли 15 лет. Только в 1995 году под маркой «Элицина» был выпущен первый восстанавливающий кожу крем с фильтратом улиточной слизи. Стоит заметить, что женщинам Южной Америки было известно о полезных свойствах улиток и раньше, они по обыкновению собирали слизь и наносили её на кожу.

После публикаций научных исследований испанских и американских учёных о восстанавливающих свойствах улиточных секреций этим  активно заинтересовались корейские производители косметики. Сейчас именно в Корее выпускается самая широкая гамма различных косметических средств с муцином; свои марки есть в Бразилии, Испании, США.

Секрет – в секрете

Лабораторно доказано, что клеточная структура муцина идеально совместима со структурой кожи человека. Муцин на 90% состоит из воды, а остальные 10% это кладезь веществ, необходимых для сохранения здоровья и молодости кожи. В его составе коллаген, гликолевая кислота, аллантоин, витамины группы А, В, Е.

У улитки муцин отвечает за процесс минерализации и формирование улиточной раковины. Улитки производят два типа слизи. Один тип помогает ей двигаться, смачивая поверхность. Второй тип слизи выделяют специальные железы улитки в ответ на физический стресс или повреждения её раковины. Он более густой, содержит белки, полисахариды (в том числе и гиалуроновую кислоту), минеральные соли и активно стимулирует регенерацию клеток, восстанавливая повреждённый «домик». Именно этот тип слизи является ингредиентом для косметики.

В составе секрета улитки и кроется секрет тренда косметики на основе муцина в мировой бьюти-индустрии. Коллаген и эластин отвечают за упругость и эластичность, гиалуроновая кислота помогает бороться с сухостью, делает кожу гладкой и светящейся. Гликолевая кислота отшелушивает отмершие клетки, а аллантоин сужает поры. Витамин А борется с воспалениями, витамин Е предотвращает появление морщин. В общем, это действительно мощный косметический актив, содержащий компоненты, прекрасно работающие со зрелой, проблемной и чувствительной кожей.

В косметологии используется несколько видов улиток.  Прежде всего, это хемициды — садовая улитка, распространённая в Японии. А наиболее популярными для улиткотерапии (вам знаком этот новомодный термин?) являются ахатины.

Прикосновение к тайне ахатин

Все научные статьи и исследования о жизни, строении улиток, составе их полезного секрета теряют свою весомость при непосредственном общении с этими удивительными существами.

Моя любовь к ахатинам случилась не вдруг и не с первого взгляда. Информация о пользе и оригинальности улиткотерапии доходила до меня давно, но приблизиться к этой теме особого желания не возникало. Пока я впервые не взяла ахатину в руки, находясь в гостях у подруги, которая занимается их разведением.

Наблюдать за неспешными движениями (как при замедленной съёмке) в наш скоростной век для меня оказалось занимательным.

Скольжение улитки вызывало ощущения сродни медитации. Муцин муцином, но общение ахатин друг с другом и с человеком погружает в другой мир и дарит спокойствие, настроения нежности и доброты.

Но это лично мои ощущения и впечатления, не смею никому их навязывать. Могу сказать только, что после наблюдений за ахатинами и общения с ними наступает состояние внутреннего покоя, гармонии. Да, это очень успокаивает нервную систему. Когда ты берёшь в руки ахатину и она начинает свой медленный завораживающий танец, время словно останавливается.

Кстати, в Египте и Вавилоне улитка была символом вечности. В буддизме она олицетворяет терпение, а её раковина – застывшее время.

Так и есть – медленный танец вне времени…

  • Домашние питомцы

В странах с влажным тропическим климатом ахатины живут и здравствуют во множестве. Белорусский климат этим брюхоногим моллюскам не подходит, поэтому у нас они встречаются только как домашние питомцы.

И это идеальное домашнее животное для занятых людей: если надо уехать в командировку надолго, домашняя улитка вполне обойдётся и без вашего внимания. Основным достоинством улиток является их нетребовательность к условиям содержания.  Для ахатин подходят небольшие аквариумы, террариумы или пластиковые контейнеры объёмом от нескольких литров до нескольких десятков литров (в зависимости от размера питомцев и их количества). Понятно, что выгуливать улитку нет необходимости, она не оставляет шерсть, не шумит, неприхотлива в еде, не вызывает аллергию. Финансовые затраты тоже незначительны: кормятся они овощами и фруктами в небольших количествах. Однако им обязательно нужен кальций в виде минеральных добавок для построения «домика».

Немного об улиткотерапии

Для нашей страны это новомодная косметическая процедура по омоложению. Прямых противопоказаний для проведения улиткотерапии нет, слизь ахатин гипоаллергенна. Выведенные в домашних условиях улитки опасности для здоровья человека не представляют, паразитов не переносят (в отличие от диких, взятых из природы).

Улиток перед началом массажа  обязательно надо «умыть» (промыть в проточной воде). Кожу человека также очищают от загрязнений и косметики тёплой водой, а лучше — отваром ромашки, обрызгивают сливками, и затем высаживают ахатин (на лицо, руки, шею, спину или другие части тела). Во рту у улиток есть радула — скребок, который состоит из десяток тысяч хитиновых зубов. Укусы безболезненны и неощутимы, но именно они отвечают за чистку и пилинг кожи.

В среднем улитки «ходят» 15-25 минут, оставляя «следы» из своего целебного секрета. Затем ахатин снимают, дают коже впитать слизь ещё минут 10-15 и смывают тёплой водой. Из минусов: есть некоторые болезненные ощущения, когда улитка чистит поры. Психологическим «противопоказанием» к процедуре может стать страх улиток или брезгливость. 

В реальности массаж живыми улитками-ахатинами дарит помимо пользы для тела незабываемые эмоции. Ползая, улитка совершает своим тельцем волнообразные движения, которые воздействуют на чувствительные рецепторы и нервные окончания кожи лица, рук, ног, спины. Мы получаем тройной эффект: расслабляющий массаж, питание кожи муцином и пилинг верхнего ороговевшего слоя кожи.         

Процедура полезная, вне всяких сомнений, важно помнить однако, что в послеоперационный период и при открытых ранах медики рекомендуют воздержаться от общения с улитками.

Лара КАРПОВА

Фото автора

косметология с улитками

В последние несколько лет все чаще используют улиток в косметологии. Некоторые производители изготавливают очень качественные и дорогие крема на основе улиточной слизи, которая способствует омолаживанию кожи и более быстрому заживлению ранок без образования рубцов. Также растет популярность использования живых улиток в косметических целях. При этом помимо действия самой слизи на кожу человек получает еще и легкий пилинг, так как улитки подъедают верхние отмершие клетки кожи, даря нам приятные щекотливые ощущения, а также легкий поверхностный массаж выбранного участка тела или лица.

Ниже мы приводим несколько полезных рекомендаций для тех, кто планирует использовать улиток в косметических целях. Мы учитываем статистику продаж, и понимаем, что среди тех, кто заводит улиток под данное направление, большинство являются новичками в улитководстве, а потому акцентируем внимание на некоторых вопросах, понятных любому опытному заводчику.

 

Как подготовить лицо или нужный участок тела к процедуре:

  1. Чтобы не навредить здоровью улитки, а также для достижения наибольшего косметического эффекта, запомните главное правило: кожа должна быть чистой! Это означает, что на ней не должно быть грязи, пота и никаких кремов, пудры и прочих благ химической промышленности.
  2. Чтобы правильно очистить кожу перед процедурой рекомендуем использовать не пахнущие средства, и максимально натуральные. В идеале это, конечно, хозяйственное мыло, но к сожалению, кожа не каждого человека его воспримет. Поэтому будем рекомендовать детское мыло с минимальным количеством химических добавок. Также у нас Вы можете приобрести еще более мягкое по своему действию на кожу красивое мыло ручной работы без искусственных ароматизаторов и отдушек, например, в виде улитки, сердца или цветочка (см. страницу «авторские штучки»).
  3. Если кожа воспринимает подобные средства, особенно если она жирная, то вместо, либо помимо мыла для очищения кожи хорошо использовать натуральную косметическую глину (только без солей, не с мертвого моря, обычную голубую, белую и т.п., какая Вам больше подходит). Натуральная глина никак не навредит улиткам, в отличие даже от душистого мыла, а загрязнения все удалит. Чем более чувствительная кожа, тем меньше по времени нужно ее держать, часто, намного меньше, чем написано на упаковках, иногда даже не давая полностью высыхать.
  4. Чтобы на коже осталось как можно меньше частичек мыла или другого моющего средства рекомендуем протереть кожу травяным настоем. Идеально подойдет настой ромашки, если у Вас, конечно, нет аллергии на ромашку. Также можно использовать череду, подорожник и некоторые другие травы. Для этого достаточно залить небольшое количество сушеной травы кипятком, накрыть крышкой, и дать настояться. (Без использования спирта!) Смочив ватный диск настоем протереть лицо или другой участок тела, на который планируется сажать улиток. Такой настой не только снимет оставшиеся загрязнения, мыльную пленку и уберет лишние запахи, но и благотворно повлияет на состояние эпидермиса, уменьшая любые раздражения и обеззараживая мелкие ранки. Это хорошо не только для Вас, но и для Ваших питомцев. Хотя процедура, конечно, не обязательная, но весьма полезная.
  5. Чтобы улитки во время процедуры вели себя активно, поверхность, по которой они будут ползать должна быть влажной. Сейчас в интернете часто встречаются не очень грамотные рекомендации использовать для увлажнения молоко. Конечно, совсем плохо от молока никому не будет, но это не самый лучший вариант. Во-первых, молоко имеет свойство скисать. А магазинное зачастую даже не сворачивается, а тухнет. Во-вторых, в природе улитки не доят коров. В-третьих, пакетированное молоко содержит пальмовое масло, которое точно никому не полезно, т.к. оно не усваивается и не впитывается. Идеальным вариантом было бы заменить молоко на дольку огурца. Это и для кожи очень полезно, и улитки почувствуя запах и вкус любимой пищи активизируются и начнут стараться доставить Вам удовольствие изо всех сил. Если же под рукой нет огурца, то побольше смачивайте ваткой с тем же ромашковым настоем, что тоже неплохо. В крайнем случае, воспользуйтесь обычной чистой отстоянной или родниковой водой.

Как выбрать улитку:

 

Изначально в косметических целях использовали хелицид – виноградных улиток и некоторых других их родственников. В первую очередь это обусловлено банально ареалом обитания тех или иных видов в странах, где популярны данные процедуры. В последствие оказалось, что слизь ахатин обладает теми же полезными для кожи свойствами, и их использование ничуть не уступает своим эффектом. Рассмотрим преимущества и недостатки использования различных улиток в косметических процедурах.

 

1. Хелициды. Не крупные улитки, как правило очень шустрые, которым практически не требуется белковая подкормка. Тем не менее они с радостью соскребут с Вашего лица весь старый отмерший эпителий, даря «пациенту» приятые щекотливые ощущения. Так как улитки не крупные, то и радула (твердая пластина во рту, выполняющая роль зубов) тоже небольшая, а значит и откусить лишнего не сможет. За счет своего шустрого характера они не станут зависать на одном месте и вгрызаться в одну точку. Недостатком является необходимость одновременного использования многих особей в связи с малой площадью ноги. Они идеальны для использования в салонах, но в домашних условиях когда Вы одни, уследить за небольшим шустрым стадом бывает проблематично.

 

2. Ахатины детеныши. Преимущества и недостатки примерно те же. Дополнительное преимущество для тех, кто стремится к более качественному пилингу, так как ахатины склонны к более обильному поеданию белковой подкормки в своем рационе. При этом имея маленький ротик улитята будут равномерно по чуть-чуть снимать верхний слой. Дополнительным недостатком служит более хрупкая раковина, с которой сложнее обращаться.

 

3. Взрослые ахатины. С одной стороны, только с помощью взрослых ахатин Вы сможете достигнуть эффект массажа. Вместе с тем очень удобно, что у неё широкая поверхность ноги, и одной улитки достаточно, чтобы провести полноценную косметическую процедуру. Но будьте очень аккуратны – у улитки уже сформировалась большая твердая радула, и на поверхности Вашей кожи она легко может оставить дырку.

 

4. Средние ахатины. Оптимальный размер, чтобы соблюсти баланс между использованием минимального количества улиток с не особой хрупкостью раковины и не особой кусачестью 5-8 см. 5 или 8 – решать исключительно Вам, кому как больше нравится. Если Вы хотите подольше использовать улиток в данном размере, чтобы они не перерастали очень быстро, попросите специалиста подобрать Вам «нерастушек» уже нужного Вам размера. В любом выводке всегда попадается пара-тройка таких. Живут они как правило не меньше, просто не вырастают больше отведенного им природой размера. Это примерно как карлики у людей, ничем не хуже, только меньше. К тому же стоить они будут значительно дешевле. И еще одно преимущество «нерастушек» для Вас – за счет более медленного роста у них более прочный панцирь, который при частом пересаживании во время процедуры не так легко будет повреждаться.

 

5. Как выбрать вид ахатин. В целом, использовать можно любой вид. Начнем с недостатков. Иммакуляты и молодые ретики бывают очень жадными до белка. Однако это компенсируется у ретиков легким привыканием к контакту с человеком, а у иммакулят (наиболее известные среди них — пантеры) наибольшей среди ахатин стрессоустойчивостью, что немаловажно при использовании в косметологии.

Ретики еще и слишком быстро растут, являясь одними из самых крупных ахатин. Архи овумы и сутуралисы немного пугливы и медлительны. Тигры дорого стоят. Занзибарики слишком не устойчивы к стрессам. Почти то же можно сказать о мегасах, хотя их мягкое тело очень приятно на ощупь. Очень хороши глютинозы, но они редко встречаются (чаще за них выдают фулик). Пожалуй, исходя из всех перечисленных качеств, золотую середину занимают, например, самые обычные фулики и пантеры. Если говорить о фуликах, спользовать можно и хемелек, и родашек, и альбиносов, и темноногих. Цветовые вариации не на что не влияют. При желании использовать крупных улиток, многие отдают предпочтение ретикулятам, благодаря их дружелюбности и любознательности. Покормив на кануне белковым кормом иммакулят, можно решить вопрос с излишними погрызами, и использовать иммакулят, у которых есть два преимущества: они очень шустрые, и они вырастают не самыми большими (до 18 см максимум). Архахатины, если их часто брать на руки, привыкают и перестают бояться. Вот только с занзибариками Вы вряд ли что-то сделаете.

Исходя из всего вышесказанного, при выборе улиток для косметологии, ставьте на первое место эстетические свойства, т.е. кто понравился внешне. Если же Вы все же хотите чтобы решили за Вас, то определитесь прежде всего с размером, который Вы будете использовать. Если Вы хотите приобрести малышей, то берите лучше кого-нибудь из фулик. Если же Вы остановились на среднем размере, то абсолютно все равно кого Вы возьмете, если Вы заводите «нерастушек» или медленно растущих особей. Ну а если Ваш выбор пал на большую особь, то это скорее ретик. Хотя это уже серьезное животное, и тут стоит посмотреть все доступные варианты. И в любом случае, решать Вам.

 

Как правильно использовать улиток:

 

1. Если Вы используете много маленьких улиток, особенно если это виноградные улитята или другие хелициды, и рассчитываете на качественный пилинг (избавление от старых отмерших клеток), то хотя бы за сутки до процедуры улиток не следует кормить. Но это не означает, что в террариуме не должно быть кальция – кальций должен лежать всегда.

 

2. Однако, если Вы остановились при выборе улиток на ахатинах, особенно если это уже достаточно крупные особи, то чтобы улитки не кусались, обязательно на ночь перед днем использования добавьте в рацион любую белковую подкормку. Особенно если планируете сажать улиток на участки с нежной кожей.

 

3. Поскольку улиток за время проведения процедуры придется трогать много раз, пожалуйста, научитесь их брать правильно, чтобы не повреждать им панцирь и не травмировать тело. Как правильно брать улитку Вы можете посмотреть тут: ……..

 

4. Перед процедурой следует позаботиться не только о своей гигиене, но и о чистоте улиток. Заранее (хотя бы минут за 10-15, как раз, пока будете подготавливать лицо) высадите улиток в ванночку с чистой водой. Лучше, если вода будет чуть теплее комнатной температуры и температуры в террариуме – улитки тогда активизируются и будут пошустрее. Но не забывайте, что они хладнокровные, и температура нашей ладони (34-36оС) это для них уже довольно горячо. То есть ладонь все же должна ощущать легкую прохладу чтобы не нанести ожег улиткам. Настоятельно рекомендуем использовать при этом обычный аквариумный (цена вопроса 50 руб) или любой другой термометр. Рекомендованная температура для непродолжительного купания 26-30 оС для ахатин, и 25-28 оС для виноградок.

Уровень воды лучше сделать максимальным, лишь бы улитки не утонули. В воду можно добавить немного настоя ромашки. При добавлении изменение оттенка воды должно быть едва заметным, не насыщенным. С другими травами экспериментировать не стоит. Купание позволит снять с моллюсков ранее выработанную подсохшую слизь, частички грунта и кусочки пищи, если таковые на них имеются. Также вбирая воду через поверхность ноги, они смогут вырабатывать ползая по Вам больше слизи, которая станет менее густой и лучше впитается в кожу.

 

5. После процедуры улитку также стоит искупать в течение 10-15 минут. Можно в той же воде, даже если она остынет до комнатной температуры. Если в комнате, конечно, не слишком холодно.

 

6. Нам часто задают вопрос: «какой грунт лучше использовать в террариуме, если мы планируем использовать улиток в косметологии?» Использовать можно любой грунт, допустимый для содержания улиток, так как они сами могут существовать только в экологически чистых условиях. Лишь бы заводчику было удобно с данным видом грунта обращаться и для улитки безвредно. Но использование в данных целях также накладывает и дополнительные требования – для многих из Вас важно, чтобы грунт легко сходил с поверхности улитки во время купания, и чтобы это всё эстетически аккуратно смотрелось. С этой точки зрения, наверное, мы все же порекомендуем Вам мох. Веточки мха проще снять с улитки, и если даже небольшие частички остались все же на ноге, они светлые, а потому эстетичнее смотрятся, и главное – мох является природным антисептиком, а потому если даже что-то будет попадать на лицо или тело, то это не только не вредно, но даже полезно. А потому даже очень мнительным людям психологически со мхом будет проще иметь дело.

 

7. Если Вы сажаете на себя взрослую особь, то обратите внимание на ее поведение. Если улитка стала очень тяжелой, и стремится закопаться, в то время как все остальные активно изучают просторы террариума, то не откапывайте её, вероятно она беременна и пытается отложить яйца. Если потревожить животное во время родов, иногда это может привести даже к гибели питомца.

 

8. Если улитка замешкалась на одном месте во время процедуры, и увлеклась подъеданием Вашего эпителия, то аккуратненько подтолкните ее вперед на новое место, чтобы слой за слоем она не оставила на Вас дырку. Особенно это касается крупных ахатин.

Приятных и эффективных Вам процедур!

 

 Внимание!!! Текст авторский. При копировании и использовании любой части текста или смысловой нагрузки обязательна ссылка на данную страницу!

Исследования слизи улиток Ахатин|Киев|massagik

Химический анализ состава слизи показал, что он содержит множество натуральных компонентов, которые обычно используются в косметологии:

Натуральный аллантоин – главный регенератор кожи, а также антиоксидант, помогающий бороться со свободными радикалами, которые ускоряют возрастные процессы. Он естественно вырабатывается улитками для восстановления их собственных тканей и раковин при их повреждении, поэтому в отличии от других косметических препаратов, содержащих синтетический аллантоин, он быстро впитывается и эффективно действует в глубинных слоях кожи.

 

Аллантоин оказывает омолаживающий и регенерирующий эффект на кожу. Под его воздействием кожа начинает регенерировать и вырабатывать коллаген. Следующий эффект аллантоина устремлён на защиту раздраженной кожи, травмированной ультрафиолетовыми лучами, химическими средствами и механическим раздражением.

Он предотвращает возникновение пятен на коже, считается сильным антиоксидантом, противоборствующим против свободных радикалов, которые содействуют старению кожи.

 

Натуральный коллаген – протеин, который является главным компонентом для соединительной ткани кожи, поддержания ее эластичности и упругости(поддерживает и укрепляет кожу),стимулирует утраченную скорость синтеза собственного коллагена и эластина дермы.

 

Натуральный эластин это протеин, который отвечает за эластичность, упругость соединительной ткани, мы знаем, что эластичность уменьшается с возрастом.
Пептиды антибиотика-уничтожает патогены, являются защитой от наиболее распространенных видов кожных бактерий, а именно: Eschericia coli, Staphylococcus aureus, Pseudomanas aeruginosa, а также прыщей.

Помогает формировать защитный барьер кожи.
Витамины содержащиеся в экстракте поддерживают нормальное состояние кожи, а именно: питают, смягчают, увлажнят, защищают, снимают воспалительные процессы, выравнивают и освежают цвет лица.(Витамин (A) укрепляет и питает кожу, Витамин (С) помогает поддерживать коллаген и является антиоксидантом, Витамин (Е) является антиоксидантом и способствует увлажнению кожи. Все витамины вырабатываются улитками естественным путем на основе их растительной диеты.

Кислота гликолевая-помогает в процессах отслоения кожи, очищения кожи, удаление мертвых клеток с поверхности кожи.Активизирует выработку эластина и ведет борьбу с возрастным изменением пигментации кожи.
Натуральный солнечный фильтр-блокирует ультрафиолетовую радиацию.

 

Ахатины, согласно исследованиям, вырабатывают самую полезную для кожи слизь по сравнению с другими улитками.

Улитки способствуют не просто заживлению, а полному восстановлению кожи.
Не вызывая аллергической реакции, по сравнению с косметическими кремами и другими обитателями раковин, к примеру как устрицы.

Массаж Ахатинами сегодня на пике популярности. Это одна из самых экзотических косметологических процедур, которая направлена на омоложение кожи.

добрая сила: Как пользоваться сухой улиточной слизью для красоты кожи

Помните пословицу: «Тише едешь – дальше будешь»? Впереди планеты всей оказалась медлительная и неповоротливая улитка, которая и не думает спешить, передвигаясь по дорожкам сада. Улиточные кремы нынче на пике популярности. Но очень эффективно в салоне или дома применять интересный натуральный продукт — сухую улиточную слизь. Она насыщает кожу полным набором ценных веществ, сохраняя ее красоту и продлевая молодость. И в отличие от содержимого промышленных косметических баночек, не содержит консервантов и синтетических добавок. Заинтригованы? Как пользоваться сухой улиточной слизью в домашних условиях, расскажем в сегодняшней статье.

Прежде чем перейти к практической части, поговорим о свойствах сего популярного космецевтического компонента. Так ли он хорош, как его малюют? Попробуем в этом разобраться.

Почему улитка? 

Ее можно величать скороходом, быстро приводящим в порядок наши кожные покровы. Улиточная слизь (она же секрет, она же муцин) – кладезь полезных веществ. Так, в секрете улиток ахатин обнаружены натуральные коллаген и эластин, витамины А, С, Е, природные пептиды, успокоитель кожи аллантоин. Также в ней есть гликолиевая кислота, способствующая отшелушиванию кожных тканей и возвращению им свежести и гладкости. Все, кто интересуется новыми технологиями косметики, узнают названия модных ингредиентов «супер-действенных» кремов. Но при этом в муцине ахатин нет ни грамма синтетики, всё вырабатывается природным путем. А стало быть, очень «вкусно» для нашей дермы.

И это еще не всё. Такая слизь содержит и ахаран сульфат –
вещество, предупреждающее закупорку кровеносных сосудов. Этот компонент поддерживает циркуляцию крови в дерме и, соответственно, способствует снабжению кожи питательными элементами на оптимальном уровне. Ахаран сульфат сходен по строению с гиалуроновой кислотой. Он обнаружен только в регенерационной слизи улиток ахатин.

Муцин улитки можно именовать «фабрикой молодости». Ведь он содействует естественному восстановлению кожи и стимулирует в ней выработку фибробластов. (А именно фибробласты ответственны за синтез гиалуроновой кислоты, факторов роста, эластина, коллагена – веществ, которым мы обязаны свежему, гладкому и упругому виду кожи). И это не голословное утверждение. Молодильные свойства регенерационной улиточной слизи научно доказаны. В частности, об этом опубликована статья в журнале International Journal of Cosmetic Science за 2012 год. Подробнее об источнике информации здесь. 

А еще секрет ахатин помогает при акне, возрастной пигментации, способствует уменьшению шрамов, растяжек (стрий), решает и другие проблемы с кожей. И, конечно, дает чудесный омолаживающий и лифтинговый эффект.


Почему сухая?

Логично использовать свежую слизь. Но, к сожалению, в отличие от snail порошка, ее срок хранения очень невелик. К тому же ответственные изготовители задействуют особенные технологии, которые позволяют получить практически нативный (то есть находящийся в природном состоянии) и максимально полезный для кожи улиточный муцин. Именно к такому добросовестному изготовителю автор статьи и обратился за помощью в подготовке материала. 

Также для создания такого продукта используется особенная регенерационная слизь, названная так по функции, которую она выполняет в организме улиток. Она выделяется при помощи специальной технологии в лабораторных условиях. В частности, такая технология была разработана группой украинских ученых для производства космецевтического препарата Achaslim. В то время как в салонной процедуре, известной как улиткотерапия, идет воздействие трекового муцина. Он значительно уступает по своим свойствам регенерационному. И именно «слизь Р», а не «слизь Т» является объектом уже упомянутых научных исследований.

Как же ею пользоваться?

Всё очень просто.

1. Заливаем порошок 1 мл кипяченной или дистиллированной воды комнатной температуры. Для точности и удобства можно задействовать шприц без иголки. Наливать жидкость желательно прямо в пробирку.

2. Закрываем крышку емкости, встряхиваем. Оставляем на 5-15 минут до полного растворения препарата. Периодически можно встряхнуть пробирку с разведенным водой порошком несколько раз. Также для ускорения процесса растворения можно перед закрытием крышки перемешать смесь палочкой или чистой зубочисткой.

3. Когда порошок полностью растворился, препаратом можно пользоваться.

! Концентрация может варьироваться в зависимости от рекомендации изготовителя. Не исключены и другие нюансы. Поэтому перед применением порошка обязательно читайте инструкцию. В данной статье описан способ подготовки к применению улиточного препарата Achaslim.

Консистенция улиточного муцина, готового к уходу за кожей

Сколько и когда?

  • Наносить его для омоложения и красоты кожи желательно 2 раза в день – утром и вечером. При сухой skin возможно ощущение стянутости. В этом случае следует применять увлажняющий или питательный крем. Если кожа лица жирная, то в дополнительной косметике нет необходимости. Плюс, поскольку улиточный муцин ахатин содержит гликолиевую кислоту, следует проконсультироваться с косметологом, можно ли завершать процедуру кремом с AHA-кислотами.
  • Если цель – уменьшить шрамы, следы от акне и другие косметические недостатки кожи, частота аппликаций за сутки может быть увеличена до 3 раз.
  • Курс применения для лифтинга или омоложения – хотя бы 1 месяц. Но совет с косметологом по поводу длительности использования этого продукта не будет лишним.

! Качественная сухая улиточная слизь, как правило, не вызывает отторжения кожей. Тем не менее, всегда возможны исключения. Поэтому перед первым применением обязательно сделайте тест на аллергию и индивидуальную переносимость. Это касается абсолютно всех косметических средств.

Также статья носит сугубо познавательный характер и не является руководством к действию. Применение любой косметики и косметического препарата – дело индивидуальное. По поводу использования сухой улиточной слизи и других косметических средств желательно советоваться с косметологом или дерматологом.


Курс на качество


  • Выбор продукта всегда остается за Вами. Но на рынке представлены и низкосортные товары, полученные по сомнительным технологиям. Они не обладают должным эффектом. Кроме того дешевые по цене дальневосточные дары могут быть сугубо сырьевой продукцией, непригодной для применения «в чистом виде». Поэтому перед покупкой обязательно почитайте информацию о препарате, по возможности свяжитесь с фирмой-изготовителем. И обращайте внимание на маркировку. Для ухода за кожей подходит только улиточный порошок, который позиционируется производителем как «косметическое/космецевтическое средство».



Красоты Вам и отличного настроения!


Автор благодарит за помощь в подготовке материала и фотосессию изготовителей препарата Achaslim. (Использование фото только с разрешения правообладателя). Подробности об этом улиточном продукте на странице в Фейсбуке.
Фото 2 из сети в свободном доступе.

А Вы применяли сухой секрет ахатин? Есть такое желание? Расскажите об этом в комментариях.

Болезни и лечение улиток ахатин

Причины болезней домашних улиток


Гигантская ахатина – сухопутная легочная улитка, которую в Европе и России часто можно увидеть в качестве домашнего питомца. Большие размеры брюхоногого моллюска, красивая витая раковина и внешне простой уход делает ахатин привлекательными для содержания. Однако вскоре после приобретения владелец может столкнуться с целым перечнем проблем: улитка из-за болезни может покрыться белой слизью, обрасти наростами, потерять аппетит, спрятаться в раковину, а то и вовсе уйти в спячку.

Внимание!

В отличие от наших пресноводных катушек и прудовиков, для ахатин потеря активности – серьезный симптом, говорящий, что питомец не здоров.

Улитки чувствительны ко многим факторам, способным серьезно ухудшить самочувствие ахатины. Это моллюски, привыкшие с теплому климату с высокой влажностью. При этом перегрев им также противопоказан, как и снижение температурного режима.

  • Температура внутри улитария должна быть в пределах 24-28оС при относительной влажности 96-99%.
  • Вторым фактором развития болезней может стать грунт – повышенная кислотность и плохая обработка станут отличным субстратом для развития болезнетворных грибков и бактерий.
  • Ахатины требовательны к пище. Фрукты и овощи нужно тщательно промывать перед подачей, иначе можно занести моллюску паразитов и в последующем придется организовать необходимое для улитки лечение. Должен присутствовать кальций необходимый для строительства раковины, а также витамины, способствующие его усвоению.
  • Нельзя использовать соль и бытовую химию при очистке аквариума. Нежное тело улитки чувствительно к солям и щелочам. Улитка получит химические ожоги и скорее всего погибнет.
  • Травма раковины – еще одна причина проблем со здоровьем. Внешний скелет моллюска — его панцирь, сама ракушка должна быть достаточно твердой, без расслоения, сколов и трещин. Утративший панцирь моллюск в большинстве случаев гибнет.

Самым распространённым фактором ухудшения здоровья улитки становится нарушение условий содержания и повышенное внимание со стороны младших членов семьи. Так же травматизм происходит, если питомец умудрился удрать из улитария и его случайно придавили или схватили животные.

Симптомы заболевания улитки

  • Ахатины – подвижные, достаточно прожорливые улитки. Если вы заметили, что питомец отказывается от любимых лакомств, спрятался глубоко в раковину «ушел за виток», погрузился в спячку, нужно бить тревогу.
  • Второй значимый признак – ухудшение внешнего вида: наросты, ухудшение внешнего вида раковины, усиление отделения слизи при вялом состоянии, белая «пенная» слизь, обнаружение колоний грибка или паразитов.
  • Третий признак – нарушение целостности панциря. Трещины, расслаивание, эрозия, истончение стенок раковины.

У ахатин могут развиваться опухоли. Если улитка активна – питается, ползает, то образование может быть доброкачественным. Если же с появлением опухоли состояние питомца ухудшается, то гуманно моллюска заморозить, чтобы избавить от мучений.

Уход за виток сравнивается с комой, моллюск не закрывает устье раковины мембраной, так как не может ее выстроить из-за упадка сил. Спячка проходит при закупоренной раковине. Если она продолжается больше 3 недель, улитку нужно будить. Также нужно разбудить ахатину, если крышечка-эпифрагма начала погружаться глубже в устье, а моллюск подсыхать.

Лечение панциря в домашних условиях

Наиболее часто встречающимися проблемами становятся травмы панциря и его истончение, эрозия поверхности.

  • Первые появляются ввиду падения улитки – она может соскользнуть со стенки аквариума на жесткий субстрат, камень или дно, если нет качественной подстилки. Улитку может уронить владелец при купании или взаимодействии. Моллюск может выбраться из террариума и попасть под ноги или в зубы других домашних питомцев.
  • Эрозия панциря – это чаще всего ответ на некачественный корм, когда не хватает кальция. Также причиной могут стать грибки или паразиты, истощающие улитку.

Улитки способны восстанавливать структуру внешнего скелета при условии небольшого повреждения, скола, трещины. Устранение разрушающего фактора и усиленная кальцием диета вернут питомцу целостность домика.

Если панцирь улитки сильно поврежден, можно ли его восстановить в домашних условиях?

Если повреждение серьезное, рекомендуем использовать для скрепления пластырь, медицинский клей БФ-6. Есть еще рекомендации по использованию эпоксидного клея и гипса. Важно, чтобы тело улитки не касалось этих веществ.

  • В качестве заплатки используют яичную мембрану, ту, что под скорлупой.
  • Перед лечением улитки, аккуратно искупайте ее в слабом растворе марганца или теплом отваре ромашки. Не кипяток!
  • Если произошло выпадение органов, очень аккуратно вправьте и наложите «заплату». Края зафиксируйте снаружи медицинским или эпоксидным клеем, сверху можно закрепить яичную скорлупу.
  • Сверху накладывают гипс, который после высыхания можно также покрыть специальным клеем для прочности.

Травмированную или больную улитку отсаживают от соседей и переводят на усиленное питание с добавками толченой скорлупы, пищевого мела, сепии и гамарусом.

Если улитка выпала из раковины, это может быть как последствием болезни, так и генетическим нарушением. Тело моллюска крепится к внешнему скелету мышцами. Лечение улитки в этом случаи бесполезно и в 99% означает летальный исход.

Есть мнение!

Молодая улитка может восстановить ракушку, в остальных рекомендуется заморозить моллюска из гуманных соображений.

Уход и питание

В первую очередь владельцам ахатин требуется поддерживать условия содержания: оптимальный температурный режим и влажность. В качестве субстрата рекомендуется мелкая крошка кокоса – она мягкая и нравится моллюскам, приятно пахнет.

  • Ежедневно осматривайте питомца. Делайте регулярно ванночки из ромашки или голубой глины (без добавок).
  • Один раз в неделю добавляйте в пищу 1 каплю Витри (витамины А, Д, Е).
  • Мазь прополиса и репейное масло позволяют укрепить раковину и скорее затянуть трещины. Слабый раствор марганца или йода также укрепит наружный панцирь.
  • От грибка и плесени помогает Микосептин. Хорошо от этих проблем спасает настой ромашки.
  • От глистов – трава пижмы. Пестицидный аэрозоль, применяемый для рептилий, поможет от мошки и клопов.

Поддерживайте чистоту в улитарии, давайте питомцу богатую клетчаткой, белком и кальцием пищу. Аквариум должен размещаться в стороне от сквозняков, отопительных приборов и прямых солнечных лучей.

№102052074. Все аквариумные рыбки в Алматы — Маркет!

Описание от продавца

Состав слизи улитки ахатины
Отличающаяся полезными свойствами слизь улиток представляет собой полупрозрачную тягучую жидкость. Брюхоногим она необходима для того, чтобы защищать подошву от трения и облегчать процесс передвижения. К тому же польза слизи улиток ахатин в косметологии заключается в том, что она действует как ранозаживляющее средство. Входящие в ее состав вещества способны восстанавливать поврежденную раковину улитки.

Улиточный секрет включает полезные компоненты:

Коллаген – полезный протеин, сохраняющий естественную эластичность и упругость дермы.
Аллантоин – антиоксидант, борющийся со свободными радикалами и активизирующий регенеративные процессы. Улиткам аллантоин необходим для защиты и восстановления раковины.
Эластин. Улитка ахатина, чья слизь включает эластин, полезна для кожи лица в поддержании гладкости и упругости дермы.
Витамины А, В, Е, С.
Пептиды. Служат защитой от бактерий, способных вызывать кожные заболевания.
Гликолевая кислота. Необходима для очищения дермы от омертвевших клеток и загрязнений.
Лектины – природное очищающее средство.
Полезные свойства улиток ахатин
Ахатинская улитка служит на пользу человеку сотни лет. Применение слизи позволяет:

Омолаживать кожу;
Уменьшать мимические морщины, в том числе вокруг глаз;
Избавляться от кожных заболеваний;
Увлажнять и регенерировать кожу;
Осветлять пигментацию;
Лечить шрамы. Многие женщины боятся улиток, особенно таких крупных, как ахатины, и даже не представляют, каким образом живых моллюсков могут использовать в косметологии. Возможно, вы измените свое мнение, когда узнаете, что слизь этих брюхоногих обладает лечебным эффектом.

Улиткотерапия помогает разгладить морщины, избавляет от шрамов и рубцов, угревой сыпи, веснушек и пигментных пятен. В слизи моллюсков содержатся вещества, часто применяемые в косметологии: витамины, аллантоин и коллаген. Благодаря своему натуральному происхождению они лучше усваиваются, чем из кремов и масок, произведенных промышленным путем. !Учеными доказано, что вещество, выделяемое улитками при движении, обладает омолаживающими, регенерирующими, антибактериальными, сильными антиоксидантными свойствами. Слизь улиток помогает избавиться от не глубоких морщин, рубцов, шрамов. Слизь ахатин эффективно борется с угревой сыпью и акнэ, бородавками и пигментными пятнами. Так же способствует уменьшению растяжек. И есть мнение, что слизь ахатин используется при лечение целлюлита. Поэтому, если вы заведете дома парочку ахатин, то сможете отказаться от использования дорогих кремов и различных косметических средст! Есть контейнер для улиточек 15л 2000т ЗАБИРАТЬ адрес тобаякова -ул. Жансугурова есть варианты доставки!

Целебные свойства улиток Ахатин!. Статьи компании «ЧП «Ахатина»»

Целебные свойства улиток!

С давних времен улиткам приписывали способность излечивать различные заболевания. Недаром в Вавилоне и Египте символом вечности считались именно улитки. В течение некоторого времени слизь улиток, как лечебное средство, была незаслуженно забыта. Однако в последние годы ученые уделяют немало внимания изучению слизи улиток. Свойство слизи улиток склеивать бактериальные клетки нашло применение и в лечении заболеваний дыхательной системы, таких, как бронхит, коклюш и силикоз. В старину народные целители садили улитку на кусочек сахара и после того, как он покрывался слизью, давали заболевшему коклюшем. Используя собственную слизь, улитка может полностью восстановить свою раковину. Благодаря таким мощным восстанавливающим свойствам слизь улитки нашла широкое применение в косметологии. Слизь обычных садовых улиток входит в состав многих современных косметических средств, так как обладает сильными антиоксидантными и антибактериальными свойствами. Кроме того, слизь улитки имеет уникальное свойство создавать защитную пленку, которая не пропускает влагу, но при этом прекрасно пропускает воздух.Слизь улиток также обладает мощным регенерирующим действием. Впервые на это обратили внимание на фабриках по разведению моллюсков. У работников, занимавшихся их разведением, кожа рук напоминала детскую кожу. Причем ссадины и царапины на руках разводчиков заживали намного быстрее, чем у тех, кто не соприкасался с моллюсками. Регенерирующие свойства слизи улиток обусловлены содержанием в ней аллантоина, гликолевой кислоты, коллагена и эластина. Бальзамы и кремы на основе слизи улитки эффективно борются с растяжками, шрамами и акне.Слизь садовых улиток не дает аллергической реакции. Она эффективна при лечении бородавок, ожоговых поверхностей, а также возрастных пятен.

Отзывы специалистов в области косметологии о гигантской африканской улитке ахатине не перестают удивлять и восхищать. Мало кто знает, что этот моллюск – эффективное средство для сохранения вашей красоты.

В Германии и Франции моллюски издавна применяются для изготовления косметических средств. Вы можете самостоятельно найти отзывы о специалистах, которые используют улиток для лечения шрамов, царапин и кожных язв различного происхождения. Совсем недавно изобретен омолаживающий крем из ахатин. Слизь этих гигантских улиток регенерирует клетки кожи и способствует быстрому заживанию различных кожных повреждений.

Косметологи советует использовать африканских улиток для ежедневного массажа. По отзывам специалистов, практикующих альтернативные методы лечения и ухода за лицом , ахатины прекрасно справляются с этой задачей. Предварительно улитку необходимо промыть под холодной проточной водой. Далее подготавливаете свое лицо и шею, как к обычной процедуре – очищаете с помощью косметических средств от косметики и загрязненности, втираете немного обычного молока. После – удобно располагаетесь в кресле и пускаете улитку ползать по коже. Молочная «приманка» приятна для моллюска. Постепенно он «пройдется» по всем участкам лица и шеи, оставив целебную слизь. После такого косметического «сеанса» следует вернуть животное в домик, втереть выделения в кожу и оставить так на 15 минут, как обычную маску – до полного высыхания. Результат вас приятно удивит: кожа подтянется, станет свежей и бархатистой.

Питают, увлажняют, регенерируют, омолаживают, подтягивают, лечат, устраняют: шрамы, акне, морщины, растяжки – природными биологически активными веществами, содержащимися в экстракте секреции Улитки Helix Aspersa.

Химический анализ состава экстракта показал, что он содержит множество натуральных компонентов, которые обычно используются в косметологии:

1. Натуральный аллантоин – главный регенератор кожи, а также антиоксидант, помогающий бороться со свободными радикалами, которые ускоряют возрастные процессы. Он естественно вырабатывается улитками для восстановления их собственных тканей и раковин при их повреждении, поэтому в отличии от других косметических препаратов, содержащих синтетический аллантоин, он быстро впитывается и эффективно действует в глубинных слоях кожи.

  1. Натуральный коллаген – протеин, который является главным компонентом для соединительной ткани кожи, поддержания ее эластичности и упругости, стимулирует утраченную скорость синтеза собственного коллагена и эластина дермы.

  2. Натуральный эластин – протеин, отвечающий за эластичность и упругость соединительной ткани, уменьшающийся с возрастом, улучшает тургор кожи.

  3. Гликолевая кислота – помогает в процессе отслоения кожи, ее очищения, удаления мертвых клеток с поверхности кожи, что позволяет другим компонентам глубоко проникать в ткани и оказывать регенеративное действие, увлажнять кожу и продуцировать коллаген.

  4. Пептиды антибиотика – уничтожают патогенны, являются защитой от наиболее распространенных видов кожных бактерий (Eschericia coli, Staphylococcus aureus, Pseudomonas aeruginosa и др.) и прыщей, помогают формировать защитный барьер кожи.

  5. Витамины (A, C, E) – поддерживают нормальное состояние кожи, питают, смягчают, увлажняют кожу, снимают воспалительные процессы, выравнивают и освежают цвет лица: А – укрепляет и питает кожу, С – помогает поддерживать коллаген и является антиоксидантом, Е – также является антиоксидантом и способствует увлажнению кожи. Все витамины вырабатываются улитками естественным путем на основе их растительной диеты.

  6. Натуральный солнечный фильтр – блокирует ультрафиолетовую (UV) радиацию.

Achatina fulica слизистая улучшает жизнеспособность клеток и увеличивает отложение коллагена в культуре фибробластов человека, облученной УФ-В излучением

J Stem Cells Regen Med. 2020; 16 (1): 26–31.

Гл.

Три Нурьяна

1 Докторантура по медицине и здоровью, факультет медицины, общественного здравоохранения и сестринского дела, Университет Гаджа Мада, Джокьякарта, Индонезия

София Мубарика Харьяна

2 Кафедра гистологии и клеточной биологии, медицинский факультет, общественное здравоохранение и сестринское дело, Университет Гаджа Мада, Джокьякарта, Индонезия

Йоханес Видодо Вирохадиджоджо

3 Кафедра дерматологии и венерологии, медицинский факультет, общественное здравоохранение и сестринское дело, Университет Гаджах Мада, Джокьякарта, Индонезия

Нур Арфиан

4 Кафедра анатомии медицинского факультета, общественного здравоохранения и сестринского дела, Universitas Gadjah Mada, Джокьякарта, Индонезия

1 Докторантура по медицине и здоровью, факультет медицины, общественного здравоохранения и сестринского дела, Universitas Gadjah Mada, Джокьякарта, Индонезия

2 Кафедра гистологии и клеточной биологии, медицинский факультет, общественное здравоохранение и сестринское дело, Университет Гаджах Мада, Джокьякарта, Индонезия

3 Кафедра дерматологии и венерологии медицинского факультета, общественного здравоохранения и сестринского дела, Университет Гаджах Мада, Джокьякарта, Индонезия

4 Кафедра анатомии медицинского факультета, общественного здравоохранения и сестринского дела, Universitas Gadjah Mada, Джокьякарта, Индонезия

Поступило 19 ноября 2019 г . ; Принята в печать 23 апреля 2020 г.

Copyright © Журнал стволовых клеток и регенеративной медицины

Abstract

Введение: Ультрафиолетовое излучение вызывает фотостарение кожи за счет увеличения матричной металлопротеиназы-1 (MMP-1). MMP-1 разрушает коллаген I и III типов, который составляет соединительную ткань дермы. Achatina fulica слизистая (AFM) — натуральное средство, которое оказывает защитное действие на фибробласты и коллаген.

Цель: Изучить влияние AFM на жизнеспособность клеток и отложение коллагена в культуре фибробластов человека, облученной УФ-В излучением.

Методы: Слизистая часть была извлечена из 50 улиток Achatina fulica , которых стимулировали электрическим током 5–10 В в течение 30–60 секунд и превращали в порошок в процессе сублимационной сушки. Культура дермальных фибробластов человека была разделена на шесть групп: группа 1 представляла собой нормальные фибробласты без УФ-излучения в качестве нормального контроля, группы 2-5 состояли из 100 мДж / см 2 УФ-облученных фибробластов. Группа 2 не получала лечения в качестве отрицательного контроля, группа 3 обрабатывалась PRP 10% в качестве группы положительного контроля, а группы 4-6 обрабатывались различными концентрациями AFM (3.9; 15,625 и 62,5 мкг / мл). В конце эксперимента пролиферацию оценивали с помощью анализа МТТ, кроме того, отложение коллагена измеряли с помощью анализа Сириус красный. ПЦР в реальном времени (RT-PCR) выполняли для количественной оценки экспрессии мРНК Coll I, Coll III и MMP-1, а затем для измерения отношения COL 1 / COL III.

Результаты: UVB индуцировал значительно более низкую жизнеспособность, повышенную экспрессию MMP-1 и подавление экспрессии мРНК COL I и COL III. Между тем группы, обработанные АСМ, продемонстрировали более высокую жизнеспособность клеток с подавлением MMP-1 и повышением экспрессии мРНК COL I и COL III.Отношение экспрессии COL I / III было значительно ( p <0,05) ниже в группах, получавших AFM, по сравнению с группой UVB. Среди групп, получавших АСМ, наилучшим результатом было введение 62,5 мкг / мл АСМ.

Заключение: AFM может улучшить жизнеспособность облученной УФВ культурой фибробластов человека, которая ассоциируется с подавлением MMP-1, повышающей регуляцией COL I и Col III и снижением соотношения COL I / III.

Ключевые слова: UVB-облученная культура фибробластов человека, Achatina fulica, жизнеспособность, MMP-1, коллаген

Введение

Ультрафиолетовое (УФ) излучение является основным внешним фактором, приводящим к старению кожи.Этот эффект УФ-излучения связан с воздействием солнечного света определенной длины волны. В зависимости от длины волны существует несколько типов УФ-излучения: UVA, UVB и UVC [1] . УФС-излучение с длиной волны 200-290 нм отражается озоновым слоем, поэтому его воздействие на кожу незначительно. Более короткие длины волн имеют большее влияние. UVB с длиной волны 290-320 нм дает больше энергии, чем UVA с длиной волны 320-400 нм. UVB способен проникать в эпидермис и дерму.Воздействие УФ-B связано с более высоким риском немеланомного рака кожи (NMSC) по сравнению с УФ-А. Увеличение УФ-В излучения на Земле вызывает воспалительные реакции, апоптоз и последующее повреждение кожи, такое как фотостарение [2] .

Характеристики фотостарения: морщины, потеря эластичности, сухость, хрупкость, грубая текстура кожи, телеангиэктазии и нарушения пигментации, которые указывают на структурные и функциональные изменения внеклеточного матрикса (ECM) [3] . Основным компонентом ВКМ является коллаген, который образует основной каркас соединительной ткани.Кожный коллаген, в частности, состоит из коллагена I типа [4] . Коллаген I типа представляет собой молекулу гетеротримеров, характеризующуюся тройной спиралью с тремя связанными α-цепями. Он указывает на зрелый коллаген, образует толстые волокна и поддерживает высокую прочность на разрыв. Наименьшее количество дермального коллагена — это коллаген III типа, состоящий из суперспиральных цепей α1 (III), образующих молекулу гомотримеров [5] . Коллаген III имеет тонкие волокна с низкой прочностью на разрыв и также называется эмбриональным или незрелым коллагеном [6] . С возрастом коллаген уменьшается примерно на 1% в год. Снижение количества коллагена I и III типа наряду с повышением соотношения коллаген I / III типа является показателем фотостарения кожи [7] . ММР-1 вызывает деградацию коллагена из-за увеличения реактивного кислородного стресса (АФК), вызванного воздействием ультрафиолета B [8] .

Текущие исследования направлены на открытие антивозрастных агентов из натуральных ингредиентов, растительных продуктов и экстрактов трав [9] . Achatina fulica слизистая (AFM) — натуральное средство, содержащее антивозрастные средства, которые использовались в древней медицине.Предыдущее исследование показало, что AFM содержит ахазин , антибиотик широкого спектра действия и противовоспалительный агент [10] . Более того, AFM также содержит сульфат ачарана , который представляет собой гликозаминогликан [11] , микроэлемент, медь, которая способствует синтезу коллагена, а также витамины A и E в качестве антиоксидантов [12,13] .

Соответственно, этот эксперимент был направлен на определение того, как AFM, богатый антиоксидантами, противовоспалительной активностью и гликозаминогликанами, может быть превращен в продукты с высокой конечной ценностью.В этой статье мы наблюдали защитные эффекты AFM на УФ-В-индуцированное фотостарение фибробластов, оценивая отложение коллагена, экспрессию MMP-1 и измененное соотношение экспрессии коллагена типа I / III.

Материалы и методы

Это исследование in vitro с дизайном контрольной группы только после тестирования получило одобрение этического комитета факультета медицины, общественного здравоохранения и сестринского дела Университета Гаджа Мада (Ref: KE / FK / 0682 / EC / 2018).

Слизистые и материалы улиток

AFM собирали путем активации слизистого секрета у 50 ахатинов a fulic a улиток с использованием электрического разряда 5-10 В в течение 30-60 секунд.Слизистые хранили в стерилизованном сосуде перед превращением в порошок с помощью процесса сублимационной сушки [12] . Обогащенная тромбоцитами плазма (PRP) была приобретена в отделении дерматовенерологии, факультете общественного здравоохранения и сестринского дела, Universitas Gadjah Mada, Джокьякарта, Индонезия.

Клеточная культура

Мы культивировали нормальные дермальные фибробласты человека (NHDF) для использования в экспериментах на пассажах> 4 из крайней плоти мальчиков 11-13 лет. NHDF поддерживали с использованием среды Игла, модифицированной Дульбекко (DMEM; Sigma-Aldrich Corporation, St.Луис, Миссури, США), к которым добавляли 10% тепла в активированной фетальной телячьей сыворотке (FBS), 100 единиц / мл пенициллина и 100 мкг / мл стрептомицина (Penstrep-Gibco; Invitrogen Corporation, Карлсбад, Калифорния, США) в влажность 5% CO 2 при 37 ° C. Процедуру субкультивирования фибробластов проводили с использованием трипсина. Вкратце, после промывания фосфатно-солевым буфером (PBS) клетки отделяли с использованием трипсина и культивировали с полностью свежей питательной средой.

Облучение UVB и обработки

Облучение UVB было выполнено в модели NHDFs.После 80-90% слияния NHDF промывали PBS, а затем подвергали УФ-B-излучению в свежих лунках, заполненных PBS, с помощью банка из шести УФ-ламп (Philips UVB TL 40W / 12RS; LIPI, Джакарта, Индонезия) в дозе 100 мДж / см 2 в течение 330 секунд. Затем NHDF промывали PBS три раза и сразу обрабатывали AFM в концентрациях 3,9 мкг / мл, 15,625 мкг / мл и 62,5 мкг / мл. Нормальный контроль состоял из NHDF, которые не подвергались лечению и не подвергались УФ-В-излучению, а отрицательный контроль представлял собой NHDF без какой-либо обработки и подвергался воздействию УФ-излучения, в то время как положительный контроль представлял собой NHDF, которые подвергались воздействию УФ-излучения с обработкой 10% PRP. .Затем NHDF инкубировали в течение 72 часов.

Процедура определения жизнеспособности NHDF с использованием анализа MTT

Мы использовали методику анализа MTT (3- (4, 5-диметилтиазолил-2) -2,5-дифенилтетразолий бромид) для изучения жизнеспособности NHDF путем мониторинга изменений цвета во время восстановления солей тетразолия. Через 72 часа в каждую лунку добавляли десять микролитров реагента МТТ. Затем NHDF инкубировали при влажности с атмосферой (5% CO 2 при 37 ° C) в течение 2 часов. Затем NHDF просматривали под инвертированным микроскопом.Когда внутриклеточные пурпурные кристаллы формазана стали ясно видны, среду, содержащую субстрат, удаляли и в каждую лунку добавляли 100 мкл ДМСО. Оптическую плотность (OD) считывали с помощью считывающего устройства для микропланшетов (Biorad iMark ™; Bio-Rad Laboratories, Сингапур) при λ 570 нм.

Измерение отложения коллагена с помощью Sirius red

Процедура окрашивания Sirius red была проведена для количественной оценки отложения коллагена в NHDF. NHDF промывали PBS. Кроме того, при комнатной температуре NHDF фиксировали раствором Буэна в течение 60 минут.Растворитель удаляли, и пластины ополаскивали в проточной водопроводной воде в течение 15 минут. 96-луночные планшеты сушили на воздухе в течение ночи, после чего в каждую лунку добавляли 200 мкл красителя Picro-Sirius Red (1 мг / мл в пикриновой кислоте) на 60 минут при легком встряхивании. В каждой лунке несвязанный краситель удаляли путем трехкратной промывки 0,01 н. HCl, в то время как связанный краситель растворяли в 100 мкл 0,5 н. NaOH при легком встряхивании при комнатной температуре в течение 30 минут. Оптическую плотность (OD) коллагенового красителя считывали с помощью считывающего устройства для микропланшетов (Biorad iMark ™; Bio-Rad Laboratories, Сингапур) при λ 540 нм.

Измерение экспрессии мРНК MMP-1, COL I и COL III

Количественная ПЦР в реальном времени (qRT-PCR) была проведена для количественной оценки экспрессии мРНК MMP-1, COL I и COL III. Уровни экспрессии мРНК нормализовали с использованием GAPDH в качестве контрольного гена. Вкратце, РНК экстрагировали из NHDF с помощью набора miRCURY Cell And Plant Isolation Kit (Exiqon; Lot # 32213). кДНК синтезировали с использованием miRCURY LNA Universal RT microRNA PCR Universal cDNA Synthesis Kit II, 8-64 rxns (Exiqon; Lot # 629693).РНК количественно определяли с помощью нанокапли с использованием спектрофотометра NanoVue Plus (Biochrom, подразделение Harvard Bioscience, Inc. , Гарвард, США). Количественная ПЦР была проведена с использованием протокола от Applied Biosystem 7500 FAST для ПЦР в реальном времени с использованием смеси Toyobo thunderbird® SYBR® qPCR (каталожный номер QPS-201). QRT-PCR проводили при следующих условиях: начальная денатурация при 95 ° C в течение 2 минут, затем 40 циклов денатурации при 95 ° C в течение 10 секунд, отжиг при 58 ° C в течение 15 секунд и удлинение при 72 ° C. ˚C в течение 20 сек.Метод 2-ΔΔCq использовали для оценки экспрессии мРНК MMP, COL I и COL III. Были использованы следующие праймеры:

MMP1: прямой CTGAAAGTGACTGGGAAACC и обратный GACAAACTGAGCCACATCAG,

COL I: прямой GTGCTAAAGGTGCCAATGGT и обратныйGTGGGGAATGGCAAGCAAAA;

COL III: вперед CCAGGAGCTAACGGTCTCAG и обратный CAGGGTTTCCATCTCTTCCA,

GAPDH: вперед GGAGCGAGATCCCTCCAAAAT и обратныйGGCTGTTGTCATACTTCTCATGG.

Каждую реакцию проводили в трех экземплярах.

Статистический анализ

Результаты представлены в виде среднего значения ± стандартная ошибка измерения (SEM). Односторонний дисперсионный анализ был проведен для определения любых значимых различий между группами с последующим LSD-тестом для теста множественного сравнения Post-hoc. Степень статистической значимости была установлена ​​на уровне p <0,05. SPSS 22 был выполнен для оценки статистического анализа (IBM Corporation, Чикаго, США).

Результаты

АСМ увеличивает жизнеспособность фибробластов

Воздействие УФ-В излучения вызывает гибель клеток в нормальных дермальных фибробластах человека (NDHF).Чтобы оценить жизнеспособность AFM, NDHF обрабатывали серийными концентрациями (0,49, 0,98, 1,95, 3,90, 7,81, 15,625, 31,25, 62,5,125, 250 и 500 мкг / мл) AFM в течение 72 часов после воздействие UVB (100 мДж / см 2 ). Жизнеспособность NHDF количественно оценивали с помощью анализа MTT (как описано в методах). Жизнеспособность АСМ увеличилась до концентрации 62,5 мкг / мл, но немного снизилась при концентрации 125 мкг / мл (). Следовательно, три разных концентрации (3,9 мкг / мл, 15. 625 мкг / мл и 62,5 мкг / мл) AFM были выбраны для тестирования в этом исследовании. В качестве положительного контроля PRP имел жизнеспособность в 2 раза выше, чем UVB в качестве отрицательного контроля. По сравнению с PRP, жизнеспособность NHDF 15,625 мкг / мл в АСМ значимо не различалась (p> 0,05), но жизнеспособность NHDF 62,5 мкг / мл в АСМ была значительно (р <0,05) выше, тогда как АСМ 3,9 мкг / мл была значительно ( p <0,05) ниже.

Тест на жизнеспособность фибробластов AFM в NDHF. NDHF культивировали в DMEM до 80-90% конфлюэнции и подвергали воздействию ультрафиолета B (UVB) 100 мДж / см2.Клетки добавляли с серийными концентрациями AFM или без них в течение 72 часов, а затем проводили анализ МТТ. Все данные рассчитаны как среднее ± стандартная ошибка среднего для трех экспериментов. Нормальным контролем (NC) были NDHF, которые не подвергались облучению UVB и не подвергались обработке, UVB — это NDHF, подвергшиеся облучению UVB и не подвергавшиеся лечению, UVB + PRP были NDHF, подвергнутые облучению UVB и получившие обработку PRP 10%, и UVB + AF были ли NDHF подвергнуты УФ-В облучению и обработаны АСМ в различных концентрациях (мкг / мл).

AFM подавляет экспрессию мРНК MMP-1

УФ-облучение увеличивает экспрессию мРНК MMP-1, которая запускает деградацию фибриллярного коллагена, особенно коллагена типа I и III в дерме. Чтобы наблюдать эффекты AFM на UVB-опосредованную экспрессию мРНК MMP-1, уровни мРНК были количественно определены с помощью qRT-PCR. После UVB-облучения NDHF инкубировали в течение 72 часов с концентрациями AFM 3,9 мкг / мл, 15,625 мкг / мл и 62,5 мкг / мл. Как показано на фиг.1, индукция UVB в группе UVB продемонстрировала значительно более высокую экспрессию мРНК MMP-1 по сравнению с нормальной контрольной группой (NC).Значительно более низкая экспрессия мРНК MMP-1 была показана в группах, получавших PRP и AFM. В группе AFM мы обнаружили значительные различия между AF62 по сравнению с AF3 и AF15, но не было существенной разницы между AF3 и AF15. AFM увеличивал отложение коллагена, экспрессию мРНК COL I и COL III с пониженным соотношением COL I / III.

Количественное исследование экспрессии мРНК MMP-1 методом ПЦР. NHDF индуцировали УФB 100 мДж / см2 и вводили с различными концентрациями AFM (3.9 мкг / мл; 15,625 мкг / мл и 62,5 мкг / мл). Значение представлено как среднее ± SEM. * p <0,05 указывает на значимость по сравнению с нормальным контролем. #p <0,05 указывает на значимость по сравнению с UVB. $ p <0,05 указывает на значимость по сравнению с PRP. Нормальным контролем (NC) были NDHF, которые не подвергались облучению UVB и не подвергались обработке, UVB - это NDHF, подвергшиеся облучению UVB и не подвергавшиеся лечению, UVB + PRP были NDHF, подвергнутые облучению UVB и получившие обработку PRP 10%, и UVB + AF подвергались ли NDHF воздействию УФ-В излучения и обрабатывались различными концентрациями (3.9 мкг / мл; 15,625 мкг / мл и 62,5 мкг / мл) AFM.

Эффект in vitro AFM на отложение коллагена NHDF количественно оценивали связыванием красителя Сириус красный и спектрофотометрией. Инкубация NHDF в течение 72 часов с различными концентрациями AFM после облучения 100 мДж / см 2 UVB вызвала увеличение количества отложений коллагена NHDF (). Красные пятна представляют отложение коллагена. В группе UVB отложение коллагена было ниже, чем в нормальной контрольной группе ( p <0.05). Более того, механизмы отложения коллагена были более компактными и регулярными в группах АСМ (). Самая высокая концентрация AFM (62,5 мкг / мл) показала значительно ( p <0,05) более высокое отложение коллагена. Подтверждающий эксперимент оценивал тип коллагена с помощью qRT-PCR исследования отношения COL I, COL III и COL I / III ().

A. Репрезентативные фотографии окрашивания Сириусом красным для отложения коллагена. Показано положительное окрашивание в красноватый цвет. Б. Интерпретация количественной ПЦР (кПЦР) экспрессии мРНК COL I, COL III и отношения COL I / III.Группа UVB + AF62 продемонстрировала значительно более высокую экспрессию мРНК COL I и COL III по сравнению с группой NC. Группа UVB продемонстрировала значительно более низкую экспрессию мРНК COL I и COL III по сравнению с группой NC. * p <0,05 указывает на значимость по сравнению с нормальным контролем. #p <0,05 указывает на значимость по сравнению с UVB. $ p <0,05 указывает на значимость по сравнению с PRP.

Обсуждение

Этот эксперимент выявил молекулярный механизм AFM для увеличения жизнеспособности клеток и отложения коллагена в культуре фибробластов человека, индуцированной УФ-В, путем изменения MMP-1 и соотношения экспрессии мРНК коллагена I / III типа.Облучение UVB (290–320 нм) приводит к повышенной гибели клеток в NDHFs [13] . В этом исследовании жизнеспособность NDHF в группе UVB снизилась по сравнению с другими группами. Это открытие показало, что доза облучения UVB была достаточной для проведения процедур облучения в соответствии с предыдущим исследованием. UVB активирует выработку цитокинов, влияющих на митоз, апоптоз и гибель клеток. UVB вызывает образование ROS, включая супероксид-анион (O2-) или перекись водорода (h3O2) [14] .В этом исследовании мы обнаружили улучшение жизнеспособности NDHF в группах AFM по сравнению с группами UVB (). AFM содержит витамины A и E (данные не показаны) в качестве антиоксидантов, которые напрямую вступают в реакцию с ROS. АФК запускает экспрессию выработки провоспалительных цитокинов. Интересно, что AFM содержит ахазин , который, как сообщалось, оказывает противовоспалительное действие на кожу [15] .

Повышение ROS, индуцированное UVB, стимулирует синтез MMP-1. АФК активирует киназы MAP, которые инициируют белок-активатор 1 (AP-1).AP-1 выполняет важную роль в регуляции транскрипции MMP-1, которая запускает усиление MMP-1 [8] . ММП-1 является основной протеазой, которая способна инициировать фрагментацию фибриллярного коллагена в коже, особенно коллагена типов I и III, в то время как другие типы ММП дополнительно разрушают фрагменты деградированного коллагена. Коллаген состоит из повторяющейся тройной спирали, которая стабилизируется за счет сшивки с другими молекулами. MMP-1 разрушает фибриллы коллагена в центрах тройной спирали.Следовательно, увеличение MMP-1 вызывает накопление фрагментов коллагена и повреждает структуру и функцию ECM [16] . Наше исследование выявило повышенную регуляцию экспрессии мРНК MMP-1 после воздействия UVB (), в то время как обработка AFM подавляла экспрессию мРНК MMP-1. По сравнению с PRP в качестве положительного контроля AFM оказывает большее влияние на подавление MMP-1. Предыдущее исследование показало, что PRP является мощным антивозрастным материалом, способным ингибировать экспрессию мРНК MMP-1 и усиливать синтез коллагена [17] .

Коллаген, синтезируемый фибробластами, является основным компонентом внеклеточного матрикса. Он составляет основную структуру и покрывает 70-80% сухой массы соединительной ткани. Характерной чертой структуры является повторяющаяся тройная спираль, которая помогает коллагену образовывать поперечные связи с другими молекулами для поддержания механической целостности и прочности на разрыв. Увеличение MMP-1 из-за облучения UVB индуцирует фрагментированный коллаген, который подавляет синтез нового коллагена и отложение коллагена [18] .Этот предыдущий результат параллелен с гистологическим проявлением в этом исследовании, которое показывает уменьшение отложения коллагена UVB, в то время как обработка AFM значительно способствовала отложению коллагена в NHDF, о чем свидетельствовало окрашивание коллагена сириусом красным.

Обычно в коже встречаются коллагены I и III типа. Коллаген I типа составляет примерно 85% -90% от общего количества фибриллярного коллагена в коже. Коллаген I — это зрелый коллаген, который имеет толстые волокна и высокую прочность на разрыв.Предыдущее исследование показало, что синтез коллагена I типа снижается в фотостарой коже [19] . Наше исследование подтвердило, что AFM активирует экспрессию мРНК COL I. Как показано на фиг.4, AFM увеличивал количество коллагена I типа, что было подтверждено количественной оценкой экспрессии мРНК COL I в УФB-индуцированных NHDF. Увеличение экспрессии мРНК COL I указывает на усиление синтеза коллагена I типа.

Меньшее количество кожного коллагена, примерно 10%, составляет коллаген III типа. Он имеет особое назначение на раннем этапе развития органов в качестве эмбрионального коллагена.Коллаген III типа — это незрелый коллаген, который имеет тонкие пучки и низкую прочность на разрыв. Количество коллагена III типа является самым высоким в период внутриутробного развития плода, а затем с возрастом уменьшается. Сложные изменения в структуре коллагена III типа приводят к снижению стабильности дермы [20] . Наше исследование подтвердило, что AFM активирует экспрессию мРНК COL I и COL III, которые были связаны с более высоким отложением коллагена на основе количественной оценки Sirius Red. Соотношение между COL I и COL III также было снижено в нашем исследовании, которое показало сходство с содержанием коллагена в более молодом возрасте.Это открытие было подтверждено количественной оценкой экспрессии мРНК COL III в UVB-индуцированных NHDF, как показано на рис.

В коже взрослого человека коллаген I и III типов составляет 80-85% и 10-15% соответственно. Во время формирования кожи типы коллагена претерпевают колебания в относительном соотношении при старении [21] . У плода соотношение коллагена I / III типа равно 1 и впоследствии увеличивается с возрастом у подростков, взрослых и пожилых людей до 2,27, 2,46 и 2,97 соответственно [7] . Повышение соотношения экспрессии мРНК коллагена I / III типа в стареющей коже согласуется с результатами этого исследования, представленными на рис. Несмотря на то, что уровень экспрессии мРНК COL I и COL III в AFM увеличивался, уровень экспрессии мРНК коллагена I / III типа был снижен. Эти данные указывают на то, что AFM стимулирует синтез коллагена. Некоторые ограничения этого исследования заключаются в том, что мы не оценивали количественно АФК и другие маркеры старения, такие как связанная со старением-β-галактозидаза (SA-βGal), p21 или p16, а сосредоточились на подавлении регуляции MMP-1 и увеличении жизнеспособности клеток и отложения коллагена.

Заключение

В этом исследовании мы продемонстрировали защитное действие AFM на культуру фибробластов человека, облученных УФ-В излучением, за счет увеличения жизнеспособности клеток, отложения коллагена, экспрессии мРНК COL I и COL III наряду с уменьшением экспрессии MMP-1.

Глоссарий

Аббревиатуры
Металлпроцессор
AFM: Achatina Fulica Mucous
ECM: Внеклеточный матрикс
MMP:
PRP: Плазма, обогащенная тромбоцитами
КПЦР: количественная полимеразная цепная реакция
ROS: Реактивный кислородный стресс
UVB

Спонсоры / Гранты

Эта работа была поддержана грантом Министерства исследований, технологий и высшего образования Республики Индонезия через Beasiswa Unggulan Dosen Indonesia Dalam Negeri (BUDI-DN) на соискание степени доктора философии. D. Стипендиальная программа (номер PRJ-1375 / LPDP.4 / 2016).

Возможный конфликт интересов

Нет

Ссылки

1. Кавинато М., Янсен-Дюрр П. Молекулярные механизмы УФ-В-индуцированного старения дермальных фибробластов и его значение для фотостарения кожи человека. Exp Gerontol. 2017; 94: 78–82. [PubMed] [Google Scholar] 2. Бош Р., Филипс Н., Суарес-Перес Дж., Хуарранс А., Девмурари А., Чаленсук-Хаосаат Дж. И др. Механизмы фотостарения и кожного фотоканцерогенеза, стратегии фотозащиты с фитохимическими веществами.Антиоксиданты. 2015; 4 ((2)): 248, 68. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Шарффеттер — Кочанек К., Бреннайзен П., Венк Дж., Херрманн Г., Ма В., Кур Л. и др. Фотостарение кожи от фенотипа к механизмам. Exp Gerontol. 2000. 35 ((3)): 307–316. [PubMed] [Google Scholar] 4. Тиггес Дж., Крутманн Дж., Фритче Э., Хенделер Дж., Шааль Х., Фишер Дж. В. и др. Признаки старения фибробластов. Mech Aging Dev. 2014; 138: 26–44. [PubMed] [Google Scholar] 5. Peng Y, Song X, Zheng Y, Wang X, Lai W. Анализ круговой РНК показывает, что circCOL3A1-859267 регулирует экспрессию коллагена I типа в фотостаренных фибробластах кожи человека.Biochem Biophys Res Commun. 2017; 486 ((2)): 277–84. [PubMed] [Google Scholar] 6. Килти СМ, ​​Грант МЭ. Семейство коллагена: структура, сборка и организация внеклеточного матрикса. В: Ройс П.М., Штейнманн Б., редакторы. Соединительная ткань и ее наследственные нарушения [Интернет]. Хобокен, штат Нью-Джерси, США: John Wiley & Sons, Inc.; 2002 [цитировано 28 сентября 2019 г.]. п. С. 159–221. http://doi.wiley.com/10.1002/0471221929.ch3 Доступно с: 7. Cheng W, Yan-hua R, Fang-gang N, Guo-an Z. Содержание и соотношение коллагена I и III типов в коже различаются с возрастом и травмой.Afri J Biotechnol. 2011; 10 ((130)): 6. [Google Scholar]

8. ван Марион М.М., Баайенс Ф.П., Мол А, Мерккс М., Руббенс М.П. Матричные металлопротеиназы и ремоделирование коллагена Обзор литературы. 2006.

10. Бисвас К., Синха Д., Мандал С. Исследование взаимодействия ахатинина, лектина, связывающего 9-O-ацетилсиаловую кислоту, с липополисахаридом в врожденном иммунитете улиток Achatina fulica. Мол Иммунол. 2000. 37 ((12)): 745–754. [PubMed] [Google Scholar] 11. Лю Дж, Чжоу Л., Хэ З, Гао Н, Шан Ф, Сюй Дж и др.Структурный анализ и биологическая активность высокорегулярного гликозаминогликана из Achatina fulica. Carbohydr Polym. 2018; 181: 433–41. [PubMed] [Google Scholar] 12. Berniyanti T, Waskito EB, Suwarno S. Биохимическая характеристика антибактериального гликопротеина из местного изолята слизи улитки Achatina fulica ferussac и их влияние на бактериальную стоматологическую инфекцию. Indonesia J Biotechnol [Интернет] 2015. https://journal.ugm.ac.id/ijbiotech/article/download/7765/6015 [процитировано 14 мая 2017 г.]; 12 (1) Доступно с: 13.Амаро-Ортис А., Ян Б., Д’Орацио Дж. Ультрафиолетовое излучение, старение и кожа: предотвращение повреждений с помощью местных манипуляций с цАМФ. Молекулы. 2014; 19 ((5)): 6202–19. [Бесплатная статья PMC] [PubMed] [Google Scholar] 14. Масаки Х., Изуцу Й., Яхаги С., Окано Й. Реактивные формы кислорода в кератиноцитах HaCaT после УФ-В облучения запускаются внутриклеточными уровнями Са2 +. J Investigate Dermatol Symp Proc. 2009. 14 ((1)): 50–2. [PubMed] [Google Scholar] 15. de la Secreción P. Оценка антимикробной активности и заживляющего потенциала слизистого секрета Achatina fulica.Int J Morphol. 2012. 30 ((2)): 365–373. [Google Scholar] 16. Цюань Т., Цинь З., Ся В., Шао Ю., Вурхиз Дж. Дж., Фишер Дж. Дж. Металлопротеиназы, разрушающие матрицу, при фотостарении. J Investigate Dermatol Symp Proc. 2009. 14 ((1)): 20–4. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Чо Дж.М., Ли Ю.Х., Пэк Р.М., Ли С.В. Влияние богатой тромбоцитами плазмы на морщины кожи, вызванные ультрафиолетом b, у мышей nude. J Plast Reconstr Aesthet Surg. 2011; 64 ((2)): e31–9. [PubMed] [Google Scholar] 18. Макпол С, Джем Ф.А., Юсоф ЯМ, Ван Нга WZ. Модуляция синтеза коллагена и экспрессии его генов в фибробластах кожи человека с помощью фракции, богатой токотриенолом. Arch Med Sci. 2011; 5: 889–95. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Яно Х., Хаманака Р., Накамура М., Сумиёси Х., Мацуо Н., Йошиока Х. Путь Smad, но не MAPK, опосредует экспрессию коллагена I типа при фиброзе, индуцированном радиацией. Biochem Biophys Res Commun. 2012; 418 ((3)): 457–63. [PubMed] [Google Scholar] 20. Наффа Р., Мейдмент С., Ан М., Ингам Б., Хинкли С., Норрис Г. Молекулярные и структурные исследования коллагена кожи позволяют выявить несколько факторов, влияющих на его структуру. Int J Biol Macromol.2019; 128: 509–20. [PubMed] [Google Scholar] 21. Мантурова Н.Е., Смирнова Г.О., Ступин В.А., Силина Е.В. Соотношение I / III типов коллагена как маркер старения кожи и прогноз результатов эстетической хирургии лица. J Pharm Sci. 2018; 10: 4. [Google Scholar]

границ | Продвижение открытия функции и применения муцинов улиток

Введение

Интриги в слизистой слизи, оставляемой улитками и слизнями, восходят к древней Греции, где они использовали слизь для уменьшения воспаления и уменьшения признаков старения (Ekin, 2018 ). Сегодня слизь улитки по-прежнему используется в средствах по уходу за кожей различными компаниями и является растущим рынком, стоимость которого, как ожидается, приблизится к 770 миллионам долларов к 2025 году (Coherent Market Inisghts, 2018). Несмотря на коммерческое применение, исследование слизи остается на удивление недостаточно развитым. Основным компонентом, который отвечает за свойства слизи, являются секретируемые муцины, семейство сильно гликозилированных белков, вырабатываемых эпителиальными клетками у большинства животных. Муцины либо связаны с плазматической мембраной, либо секретируются из клетки, и каждый тип имеет существенные различия в своих функциях и возможностях (Dhanisha et al., 2018). Связанные с мембраной муцины — это гликолипиды, которые действуют как маркеры клеточной передачи сигналов, а также защищают клетку от внеклеточных воздействий, которые могут привести к повреждению, например инфекциям и физическому перенапряжению (Van Putten and Strijbis, 2017). Секретируемые муцины могут быть гелеобразующими или негелеобразующими биополимерами. Секретируемые биополимеры образуют слизистые оболочки макроскопического масштаба. Эти слизистые оболочки составляют большую часть поверхности многоклеточных организмов, подвергающихся воздействию окружающей среды.У человека слизистые оболочки составляют 99% площади поверхности тела (Sompayrac, 2012; Ma et al., 2018; Cerullo, 2020). Каждый вид улиток секретирует несколько различных функциональных слизистых оболочек. Слизь, производимая ногой улитки, используется для прилипания и смазки, позволяя улитке прилипать к любой поверхности или ходить по ней, даже когда она перевернута. Кроме того, слизь, образующаяся на спине улитки, используется для защиты от микробов и гидратации тканей. Некоторые виды улиток используют слизь по-особенному.Например, Falsilunatia eltanini (Лунная улитка) использует слизь для защиты своих яиц, а Tikoconus costarricanus (Коста-риканская наземная улитка) использует слизь для выполнения нагрузки, например, чтобы спрятаться от солнца на нижней части листьев. во время засухи (Gould et al., 2019; Barrientos, 2020). Недавние достижения в омике (геномной, транскриптомной, протеомной, гликомической) технологии расширили возможности исследования муцинов брюхоногих моллюсков как научного ресурса с широким спектром приложений в химии, биологии, биотехнологии и медицине.Например, антимикробные свойства слизи улитки используются для борьбы с заболеваниями, наблюдаемыми у людей, от язвы желудка до послеоперационных инфекций (Amah et al., 2019; Gentili et al., 2020). Муцины также сочетаются с одобренными терапевтическими средствами, чтобы усилить способность препарата излечивать такие заболевания, как диабет и язвенный колит (Gugu et al., 2020). Кроме того, муцины улиток исследуются во множестве других биотехнических приложений, которые используют их свойства, подобные поверхностно-активным веществам (Petrou and Crouzier, 2018).Несмотря на их потенциал, мало что известно о том, как иерархические структуры муцина объясняют их разнообразные функциональные свойства. Существует неудовлетворенная потребность в изучении биологического и химического разнообразия генов муцина улитки, чтобы выяснить руководящие принципы, которые определяют различные свойства, связанные с каждым геном. В этой перспективной статье будут освещены текущие применения секретируемой слизи улиток, демонстрирующие потенциал этого биополимера как ресурса для биотехнологических и биомедицинских достижений.Мы также опишем комплексную омикс-стратегию для исследования биологического и химического разнообразия генов слизи улитки (рис. 1).

РИСУНОК 1 . (A) Аппликации слизи улитки. Слизь улитки используется для ухода за кожей, заживления ран и омоложения, а также для доставки лекарств. Слизь улиток изучается в пищевой науке, покрытия имплантатов, а в других биотехнических секторах в настоящее время исследуются муцины для изучения их потенциального использования. (B) Двумерное изображение структур муцина.Муцины характеризуются двумя частями своей структуры: их белковым ядром и их разветвлением гликанов. Ядро белка представляет собой последовательность белка переменной длины в зависимости от гена муцина, которая была дополнительно модифицирована ветвями гликозилирования. Однако структура белка имеет несколько доменов, и эти домены различаются в зависимости от функции и клеточного местоположения муцина. Гликановые ответвления представляют собой сахарные ответвления, содержащие от 3 до 18 сахаров, и составляют большую часть массы муцина.Показаны двухмерные изображения различных типов муцинов и их стереотипные характеристики. (C) Применение комплексного омического подхода к идентификации последовательности, структуры и функции муцина улитки. Путь 1 (слева) извлекает неочищенные белки муцина и отделяет их от клеточного мусора для получения масс последовательностей с помощью спектроскопических и масс-спектрометрических анализов. Путь 2 (справа) извлечение РНК из слизистых желез или всего животного с последующей сборкой de novo последовательностей гена муцина для создания базы данных для BLAST путем сравнения собранных последовательностей с известной базой данных муцина, мы получаем предполагаемые последовательности муцина. Комбинируя протеомный и РНК-конвейеры, мы подтверждаем последовательность муцина нативного типа для дальнейшего анализа.

Структурные вариации муцинов

Муцины содержат несколько доменов, которые вносят вклад в их общую функцию (рис. 1). Структурные вариации учитывают их обширное биологическое разнообразие и уникальные физические характеристики. Тандемный повторяющийся домен, расположенный в центре белковой цепи, богат серином, треонином и пролином, служит якорем для гликозилирования.Муциновые гликаны преимущественно O-связаны, но могут присутствовать незначительные количества N-связанных гликанов (Corfield, 2015). Длина домена гликозилирования и количество повторов различаются между муцинами и придают разные химические характеристики. Секретируемые муцины имеют богатые цистеином области на обоих концах домена тандемных повторов, которые используются для стабилизации, обеспечивая точки дисульфидного мостика как для межмолекулярных, так и для внутримолекулярных связей. Кроме того, эти регионы служат как для обеспечения дополнительной структурной диверсификации, так и для обеспечения мультимеризации муцинов и других биомолекул, богатых серой (Perez-Vilar and Hill, 1999).

Обычно N-ацетилгалактозамин (GalNAc) присоединяется к ядру белка через O-гликозидные связи между моносахаридом и остатками Ser или Thr (GalNAc [α1] -Ser / Thr). Это формирует антиген TN, который, как обычно обнаруживается у людей, активируется при определенных формах рака (Guillen-Poza et al., 2020). Оттуда галактоза присоединяется к структуре (Gal [β1-3] GalNAc [α1] -Ser / Thr), образуя 1 O-гликан муцинового ядра. О-гликаны различаются по размеру, от 2 до 20 сахарных остатков и по составу, так как другие сахара, такие как N-ацетилглюкозамин (GlcNAc) и фукоза (Fuc), добавляются последовательно (Brockhausen, 1999).Сиаловые кислоты и манноза также присутствуют в следовых количествах. В частности, известно, что сиаловые кислоты играют важную роль в иммунных свойствах муцинов. Сиаловая кислота опосредует межклеточные взаимодействия, а также может маскировать антигены из макрофагов человека (Yan et al., 2020). Кроме того, сиаловые кислоты являются основными точками связывания лектинов, общего семейства белков, обнаруженного в системе врожденного иммунитета (Bornhöfft et al. , 2018). Кроме того, секретируемые муцины также проявляют С-маннозилирование, где С1 маннозы связывается с индольным кольцом в триптофане, что позволяет в большей степени варьировать третичную структуру (Linden et al., 2008).

Незаметные изменения в структуре муцина, в частности, в аминокислотной последовательности и гликозилировании, могут соответствовать совершенно разным биологическим функциям (Bansil and Turner, 2006). Хотя эти белки состоят преимущественно из углеводов по массе, до 90%, как белковые, так и гликановые структуры обеспечивают общие функциональные характеристики муцину (Linden et al., 2008). Кроме того, отдельные муцины могут иметь несколько гликоформ в нормальном и патологическом состояниях, а разные популяции одного вида могут проявлять разные гликоформы (Benktander et al., 2019). Это разнообразие позволяет организмам индивидуализировать каждый муцин для конкретных физиологических и экологических условий. В целом мало что известно о связи генотипа с фенотипом генов муцина, которая приводит к различным функциональным свойствам. Идентифицировано несколько генов муцина человека, и существует по крайней мере 21 подтвержденный ген, кодирующий муцин, каждый с различной биологической активностью (Rose and Voynow, 2006). Напротив, хотя многие предполагаемые гены муцина улитки были идентифицированы, ни один из них не был подтвержден.Однако отсутствие надежных характеристик генетики и структурных различий между слизистыми оболочками улиток не препятствует их применению для удовлетворения насущных потребностей в медицинских и биотехнологических материалах.

Муцины улитки как противомикробные агенты

Устойчивые к антибиотикам бактерии становятся все более распространенной проблемой без множества жизнеспособных решений. Поскольку у моллюсков отсутствует адаптивный иммунитет, они зависят от физических барьеров и врожденного иммунитета для защиты от патогенных агентов (Гердол, 2017).У большинства улиток ступня больше всего контактирует с поверхностями, зараженными патогенами и паразитами, а выделение слизи вдоль ступней защищает от таких микробов. Одной из первых слизистых оболочек, оцениваемых на предмет антимикробной активности, была слизь Achatina fulica (гигантская африканская наземная улитка) (таблица 1) (Iguchi et al., 1982). Слизь из A. fulica (Mumuni et al., 2020) продемонстрировала многообещающую антибактериальную активность против грамположительных бактерий, Bacillus subtilis и Staphylococcus aureus , и грамотрицательных бактерий, Escherichia coli и Pseudomonas. aeruginosa (таблица 2).Секреция слизи A. fulica подавляла рост бактерий как S. aureus , так и S. epidermidis при нанесении через перевязочные пленки на мышиной модели (Santana et al., 2012). Повязки на раны улучшили созревание грануляционной ткани и скорость отложения коллагена, что, как известно, ускоряет процесс заживления (Martins et al., 2003). В аналогичном исследовании слизь Helix aspersa продемонстрировала антимикробную активность против нескольких штаммов Pseudomonas aeruginosa (Pitt et al. , 2015). Кроме того, слизь A. marginata и A. fulica использовалась в качестве перевязочного материала для 28 клинических образцов ран, собранных с известными распространенными инфекциями (Etim et al., 2016). Слизь показала антибактериальную активность в отношении Staphylococcus , Streptococcus, и Pseudomonas , выделенных из ран. В том же исследовании, по сравнению с семью распространенными антибиотиками, включая амоксициллин, стрептомицин и хлорамфеникол, некоторые выделения слизи были более ингибирующими для инфекций, чем коммерческие антибиотики.Понимание антимикробных свойств слизи улиток — активная и растущая область исследований.

ТАБЛИЦА 1 . Виды Mollusca, муцин которых применялся в различных секторах для биомедицинских и биотехнологических применений.

ТАБЛИЦА 2 . Муцин моллюска применяется как противомикробное средство для подавления патогенов.

Муцины улиток как средства доставки лекарств

Адаптивность биополимеров муцина улиток делает их уникальными перспективными кандидатами для новых систем доставки лекарств (Huckaby and Lai, 2018; Momoh et al. , 2020). Во время спаривания самцы улиток стреляют дротиком, чтобы доставить слизь, содержащую дополнительные белки, в самку, что, в свою очередь, увеличивает плодовитость самки улитки (Lodi et al., 2017). Этот процесс основан на многофункциональной системе, в которой каждый компонент играет определенную роль. Дротик действует как игла, протыкая ткань и впрыскивая слизь, несущую дополнительные белки, в самку улитки. Подобным образом слизь может действовать как вектор доставки биоактивных молекул.Известно, что слизь улитки исключительно хорошо сочетается с любыми лекарствами, которые всасываются через слизистые оболочки, из-за их способности облегчать диффузию через мембраны (Балабушевич и др., 2019). Например, метформин гидрохлорид, лекарство от диабета, был присоединен к муцину гигантской африканской наземной улитки с использованием полиэтиленгликоля (ПЭГ) для увеличения биодоступности препарата (Momoh et al., 2014). ПЭГилирование — это обычно используемый процесс, при котором терапевтическое средство окружено матрицей полимеров, преимущественно полиэтиленгликоля. Эта матрица благоприятно влияет на фармакокинетику терапевтического средства, продлевая период полужизни за счет защиты от антител и позволяя варьировать контроль биораспределения в зависимости от состава матрицы. Муцин улитки, в частности, перспективен как полимер, так как он очень гидрофильный, а также легко взаимодействует со слизистыми оболочками желудочно-кишечного тракта — обычным местом всасывания лекарств. Нагруженный метформином ПЭГилированный муцин улучшил фармакокинетику и фармакодинамику обычно плохо всасываемого лекарственного средства, увеличивая высвобождение до 92% по сравнению с 81%, используемым в настоящее время на рынке.В другом приложении цельные цветы Costus afer (имбирная лилия) в сочетании со слизью улитки показали снижение уровня глюкозы в крови у диабетиков Mus musculus (швейцарские мыши-альбиносы) дозозависимым образом, что показало возможный антидиабетический потенциал. муцина улитки (Agu et al., 2018).

Полимерная матрица, связывающая лекарство, и кристаллы муцинсодержащего ватерита использовались в качестве носителей для доставки лекарств для эффективной загрузки и контролируемого высвобождения небольших противораковых лекарств и терапевтических средств на основе белков (Balabushevich et al. , 2019). Микрокристаллы ватерита, кристаллизованные в концентрациях муцина в диапазоне от 1 до 6 мг / мл, лучше сохраняют катионную биоактивность и стабильность в физиологических условиях. Кроме того, муцины сочетаются с фотосенсибилизаторами, чтобы улучшить нацеливание и оптимизировать контроль доставки в раковые клетки ( Датта и др., 2019). Самособирающиеся многослойные капсулы с муцином и микрочастицы, содержащие муцин, представляют особый интерес для будущих исследований механизмов доставки лекарств с контролируемым высвобождением, в частности, для преодоления проблем биосовместимости, биоразлагаемости и мукоадгезии (Balabushevich et al., 2018).

Муцины улитки как противоопухолевые агенты

Муцин улитки показал терапевтический потенциал против меланомы, одного из самых опасных видов рака кожи (Ellijimi et al., 2018). В то время как новые разработки в терапии рака привели к более высоким показателям ремиссии и увеличению продолжительности жизни для больных, эти разработки не показали аналогичных результатов в отношении меланомы (Rutkowski and Kozak, 2017). Поскольку резистентность к лечению является обычным явлением для этого рака, существует острая необходимость в поиске эффективных новых подходов к лечению меланомы.Исследование слизи H. apersa на клеточных линиях меланомы показало, что слизь улитки снижает жизнеспособность и подавляет метастазирование клеток меланомы (Ellijimi et al., 2018). Снижение жизнеспособности клеток приписывали апоптотическому событию, связанному с расщеплением поли (АДФ-рибозы) полимеразы (PARP). Кроме того, подавление метастазирования было достигнуто путем блокирования функции и экспрессии интегрина и, таким образом, подавления способности рака расти (Premi, 2020). В другом исследовании H.aspersa непосредственно подавлял рост двух клеточных линий меланомы человека, увеличивая экспрессию цитокина TNFα и ингибируя NF-κB, процесс транскрипции, который при правильной регуляции был связан с прогрессированием рака, рост этих клеточных линий был снижен , демонстрируя свои антимеланогенные свойства (Domínguez-Martín et al. , 2020). Хотя применение муцинов улиток в качестве противоопухолевых агентов все еще находится на ранних стадиях разработки, интерес биомедицинского сообщества растет.

Муцины улитки способствуют заживлению ран

Слизь улиток может способствовать заживлению и стала важным ресурсом в исследованиях ран (Michael, 2012; Etim et al., 2016). Было показано, что муцины из Helix aspersa (садовая улитка) помогают в регенерации кожи после острого радиодермита, распространенного побочного эффекта лучевой терапии (Hymes et al., 2006). Сообщается, что слизь садовой улитки увеличивает скорость заживления за счет антиоксидантной регуляции и регулирования свободных радикалов (Nguyen et al., 2020). Слизь из сада улучшила эритему на моделях крыс, и те же крысы также показали снижение фотостарения (Lim et al., 2020). Помимо того, что муцины способны лечить поверхностные повреждения, они также могут использоваться для лечения внутренних ран. Муцины были включены вместе с пероральными нестероидными противовоспалительными препаратами (НПВП) для уменьшения или устранения повреждения слизистой оболочки желудка (Abdulla et al. , 2013). НПВП уменьшают воспаление, но имеют побочные эффекты, связанные с повреждением желудочно-кишечного тракта и печени.Многие компании обратились к натуральным продуктам, чтобы противодействовать этим побочным эффектам, и было показано, что муцин лечит пептические язвы — побочные эффекты, вызванные НПВП (Drina, 2017). Комбинация антибиотика, кларитромицина и муцина A. fulica показала положительные результаты при лечении язвенной болезни (Mu et al., 2008; Kabakambira et al., 2018). Помимо противоязвенных свойств, скорость заживления язв увеличивалась с увеличением концентрации муцина и была быстрее, чем при использовании одного кларитромицина.

Слизь улитки, используемая для биовоздушных материалов

Изучение природных веществ в качестве платформы для создания новых материалов привело к появлению множества революционных продуктов, таких как липитор, пенициллин и морфин. Точно так же муцины использовались в качестве покрытия из биоматериала, чтобы уменьшить отторжение неорганических имплантатов. Отказ от хирургических имплантатов из-за инфекции приводит к более 1 миллиону медицинских случаев в год, при этом стоимость первоначальной операции составляет лишь часть стоимости лечения соответствующей инфекции (Darouiche, 2004).Нанесение пленок на основе муцина на полиэтилентерефталат, обычный материал, используемый в медицинских имплантатах, значительно снизило иммунный ответ, вызванный абсорбцией IgG и IgM в пластик (Sandberg et al., 2009; Galo Silva et al., 2019). То же исследование также показало, что он снижает активацию фибриногена, известного воспалительного агента, при контакте с муциновым покрытием по сравнению с пластиком без покрытия. В других исследованиях было показано, что муцины уменьшают размножение микробов на имплантированных устройствах (Co et al., 2015). Технологии на основе муцина демонстрируют огромные перспективы в области биоматериалов.

Примером использования муцинов в качестве биоматериалов является применение муцинов в синтезе водорастворимых углеводородов. Путем лигирования муцина и / или соединений, имитирующих муцин, с гидрофобной липидной цепью углеводородный комплекс оставался суспендированным в водных условиях даже через несколько месяцев, в то время как углеводород, не входящий в состав комплекса, быстро выпадал в осадок из раствора (Chen et al., 2004). В другом родственном исследовании, проведенном группой Комбаа, это свойство было применено для улучшения определения глюкозы путем создания стабилизированной суспензии комплекса углеродные нанотрубки-муцин для биосенсора глюкозы типа сэндвич. Полученное в результате биоаналитическое устройство на 20% чувствительнее и на 40% быстрее, чем обычные устройства, которые не включают эту матрицу конструкции сенсора (Comba et al., 2018).

Муцины, которые вступают в контакт с лекарствами, всасывающимися через слизистые оболочки, также могут использоваться в хроматографии для определения биодоступности и абсорбции через мембрану (Gargano et al., 2014). Свиной желудочный муцин, связанный с колонкой с диоксидом кремния через аминопропиловые линкеры, позволяет разделить молекулы лекарственного средства по аффинности связывания со слизистой оболочкой лекарственного средства. В другом исследовании муцин был закреплен на колонке с использованием ионного обмена с альгинатом кальция, муцин иммобилизован, имитируя биологические слизистые оболочки. Более длительное время удерживания молекулы в колонке с муцином указывает на высокое взаимодействие лекарственного средства с муцином, что коррелирует с замедленной биодоступностью in vivo (Bhat, 1995).Это добавляет еще одно измерение для оценки лекарств, используемых при определенных заболеваниях, влияющих на выработку муцина, таких как муковисцидоз (Abdullah et al., 2018).

Та же самая колонка с муцином желудка свиньи использовалась для оценки сохранения вкуса в пищевой промышленности. Было показано, что колонка с муцином имитирует бычий язык для сохранения вкуса, что снижает необходимость и потенциально может исключить испытания на животных (Dinu et al., 2019). Роль муцинов в восприятии вкуса была тщательно изучена (Челебиоглу и др., 2020). Присутствие муцинов в полости рта напрямую связано с повышенным осаждением соединений, производящих аромат, что, в свою очередь, увеличивает восприятие аромата (Dinu et al. , 2020). Это явление также рассматривается как причина потери вкуса в пожилом возрасте (Pushpass et al., 2019a). Снижение уровня MUC7 в слюне было отмечено у пожилых людей со сниженным вкусом (Pushpass et al., 2019b). Считается, что это подавление снижает мукоадгезию молекул ароматизатора, что приводит к ослаблению вкусового восприятия.

Темпы улитки для характеристики молекул муцина

Несмотря на растущий интерес к этой области, все еще существует много препятствий, мешающих продвижению в исследованиях муцина улиток. Многие виды улиток, у которых есть потенциал для открытия нового муцина, часто недоступны из-за их среды обитания. Отсутствие легкодоступных образцов биологического материала и трудности с идентификацией структур муцина препятствуют надежному синтезу муцинов в количествах, достаточных для повторных экспериментов.Несколько групп исследуют устойчивые, масштабируемые подходы к производству синтетических муцинов, однако эта область находится в зачаточном состоянии (Petrou and Crouzier, 2018). В то время как муцины, выделенные из A. fulica , были тщательно изучены, другие виды остаются без внимания ( Парк, 2011).

Самым жизнеспособным методом коммерческого производства муцина остается экстракция и изоляция от животных, что не позволяет получать значительные урожаи при внесении без обильного животного капитала и обычно включает инвазивные методы.Сложность, обилие и локализация паттернов гликозилирования на каждом муцине, в дополнение к различным гликоформам муцина, затрудняют использование общих методов разделения для очистки, синтеза и анализа образцов муцина (Navarro et al., 2018). Муцины часто подвергаются посттрансляционным модификациям, таким как O-сульфатирование, N-сульфатирование и N-деацетилирование, которые различают функции белков (Краснова и Вонг, 2016). Эти посттрансляционные модификации гликанов являются препятствием для очистки, характеристики и синтеза образцов муцина.Многообещающий синтетический подход включает использование рекомбинантных бактерий, полимеризацию, опосредованную гликозилтрансферазой (GT), и транс-гликозилирование (Краснова и Вонг, 2016). Однако этих методов недостаточно для достижения промышленных практических результатов и не удастся создать исчерпывающий набор гликоформ, составляющих природные гели слизи. По-прежнему существуют трудности с созданием гликозилирования O в дрожжах, и существуют проблемы, связанные с переносом ветвей гликозилирования на выбранные белковые остатки.Эти проблемы представляют собой необходимость в разработке жизнеспособных и высокопроизводительных методов синтеза муцинов с использованием масштабируемой химии, что стало бы первым шагом в использовании муцинов в качестве целевых методов лечения или лечения (Kwan et al., 2020).

В последние годы появились -омные технологии (геномика, транскриптомика, протеомика, гликомика), которые требуют минимального количества образцов, что позволяет охарактеризовать редкие или труднодоступные образцы улиток (Gorson et al., 2015). Стратегия, аналогичная той, что была сделана с ядом улиток с использованием ядовитых веществ (Holford et al., 2018; Ананд и др. , 2019; Fassio et al., 2019), который сочетает транскриптомные и протеомные методы с программами биоинформатической сборки последовательности de novo для определения генетической структуры предполагаемых пептидных токсинов яда улитки, может быть применен для характеристики генов муцина и белков слизи (рис.1). В частности, взяв нуклеотидные последовательности собранных экзомов и затем сопоставив их со значениями протеомной массы, мы можем подтвердить линейные структуры белка муцина. В этом подходе мы извлекаем мРНК из слизистых желез или всего животного и с помощью биоинформатического конвейера идентифицируем гены муцина и последовательности первичных белков муцина.В рамках новой инициативы, Comparative Animal Mucomics Project (CAMP), будет применяться систематический сравнительный анализ генов муцина и гидрогелей слизи для определения иерархических структур и свойств отдельных слизистых оболочек (Cerullo, 2020).

Несмотря на перспективность омических методов для создания надежных баз данных муцинов, их изучение все еще остается серьезным препятствием. Одним из таких препятствий являются алгоритмы, используемые для сборки секвенированных генов. Графы Де Брёйна, которые представляют собой последовательность алгоритмов, используемых большинством ассемблеров, испытывают трудности с отображением повторяющихся доменов из-за множества схожих перекрывающихся последовательностей (Михеенко и др., 2020). В настоящее время разрабатывается множество инструментов для решения этой проблемы (Jain et al., 2020). Каждая программа изменяет весовые коэффициенты k-мер, которые используются для построения графов Де Брейна, чтобы учесть тандемные повторы. Для протеомного исследования муцинов межмолекулярные взаимодействия муцинов с другими муцинами вызывают дополнительную степень сложности. Муцины естественным образом будут создавать мультимеры сами по себе, соединяя вместе несколько белков, чтобы сформировать более крупную структуру, что регулярно наблюдается в природе (Javitt et al., 2019). Для того, чтобы затем получить единственный белок, соединенные связи должны быть разорваны, без разрыва связей одиночного белка. Однако мультимерные связи муцина трудно восстановить без влияния на остальную часть вторичной структуры одиночной цепи муцина. В настоящее время в протеомных исследованиях муцина используется метод проб и ошибок для получения единичных белковых масс. Потребуются новые методы характеристики и синтеза для точной идентификации и изготовления муцинов улиток, и с помощью подхода omics мы сможем определить отображение генотипа на фенотип, необходимое для понимания и расшифровки функциональных различий, обнаруженных в каждом образце муцина.

Заключительные замечания и перспективы на будущее

Улитки встречаются почти в каждом биоме, и условия окружающей среды, по-видимому, определяют разнообразие генов муцина и универсальность функций слизи (Lang et al., 2007; Lang et al., 2016). Муцины улиток продемонстрировали биомедицинский и биотехнологический потенциал и являются весьма многообещающим биоинспектируемым ресурсом (рис. 1). Характеристики муцинов улитки ограничиваются не их природной ценностью, а доступностью и сложностью идентификации, очистки и исследования молекулы. Остается ответить на несколько вопросов о свойствах муцинов и слизистых оболочек в зависимости от их применимого использования. Эта перспектива демонстрирует высокий потенциал урожайности муцинов улиток, и, используя адаптируемый сравнительный конвейер, мы можем лучше понять эти уникальные белки и их полезные биологические и химические свойства.

Вклад авторов

MH и MM придумали обзор. AB, AC, JP внесли свой вклад в содержание. М.М. написал первый черновик рукописи.EA, WD, SS, SS и JF написали разделы рукописи. Все авторы участвовали в доработке рукописи, прочитали и одобрили представленную версию.

Финансирование

MH благодарит за поддержку Национальные институты здравоохранения (грант NIH-NIMHD 8-G-12-MD007599). Студенческая поддержка SS была предоставлена ​​программой Hunter Yalow Scholars, JF была предоставлена ​​программой Hunter College NIH-MARC, грант № GM007823, а SS была предоставлена ​​программой Hunter McNulty. AC выражает признательность за поддержку со стороны программы стипендий CUNY Graduate Centre Graduate Fellowship и CUNY Llewellyn Fellowship. Компания AB выражает признательность Управлению научных исследований ВВС за поддержку, номер гранта (FA9550-19-1-0220).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечание издателя

Все претензии, выраженные в этой статье, принадлежат исключительно авторам и не обязательно относятся к их аффилированным организациям или к претензиям издателя, редакторов и рецензентов.Любой продукт, который может быть оценен в этой статье, или заявление, которое может быть сделано его производителем, не подлежат гарантии или одобрению со стороны издателя.

Ссылки

Abdulla, A., Adams, N., Bone, M., Elliott, A.M, Gaffin, J., Jones, D., et al. (2013). Руководство по лечению боли у пожилых людей. Возраст Старение 42, i1 – i57. DOI: 10.1093 / старение / afs200

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Abdullah, L. H., Coakley, R., Webster, M.J., Zhu, Y., Tarran, R., Radicioni, G., et al. (2018). Продукция муцина и реакция гидратации на слизисто-гнойные материалы при нормальном эпителии дыхательных путей при муковисцидозе и кистозном фиброзе. Am. J. Respir. Крит. Care Med. 197, 481–491. doi: 10.1164 / rccm.201706-1139oc

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Агу, М. О., Цваре, Б. Дж., Сандей, А. О., Онвука, Дж. К. и Энтони, Х. Дж. (2018). Исследовательское исследование долгосрочных доз Costus Afer, слизи улитки и их комбинации со стандартным фармацевтическим препаратом на уровень глюкозы в крови у швейцарских крыс-альбиносов, индуцированных аллоксаном. Open J. Med. Chem. 08, 1–14. doi: 10.4236 / ojmc.2018.81001

CrossRef Полный текст | Google Scholar

Амах, А. К., Ева, О., Карима, М. Р., Эленду, М. У. и Юнуса, З. (2019). Влияние муцина Archachatina Marginata на агрессивные факторы язвенной болезни желудка, пораженной тканью желудка крысы Wistar. GSC Biol. Pharm. Sci. 9, 077–082. doi: 10.30574 / gscbps.2019.9.1.0163

CrossRef Полный текст | Google Scholar

Ананд П., Филипенко П., Хуаман Дж., Людмер М., Хоссейн М., Сантамария К. и др. (2019). Селективное ингибирование клеток рака печени с помощью пептида яда. Мар. Наркотики 17 (10), 587. doi: 10.3390 / md17100587

PubMed Реферат | CrossRef Полный текст | Google Scholar

Балабушевич Н. Г., Коваленко Е. А., Ле-Дейген И. М., Филатова Л. Ю., Володкин Д., Викулина А. С. (2019). Гибридные кристаллы CaCO3-муцина: эффективный подход к загрузке и контролируемому высвобождению катионных лекарств. Mater. Des. 182, 108020. doi: 10.1016 / j.matdes.2019.108020

CrossRef Полный текст | Google Scholar

Балабушевич Н., Шолина Е., Михальчик Е., Филатова Л., Викулина А., Володкин Д. (2018). Самостоятельно собранные муцин-содержащие микроносители с помощью жесткого шаблона на кристаллах CaCO3. Микромашины 9, 307. doi: 10.3390 / mi

07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бансил Р. и Тернер Б. С. (2006). Структура муцина, агрегация, физиологические функции и биомедицинские применения. Curr. Opin. Коллоид Интерф. Sci. 11, 164–170. doi: 10.1016 / j.cocis.2005.11.001

CrossRef Полный текст | Google Scholar

Barrientos, Z. (2020). Новая стратегия выпадения наземных моллюсков: висеть вверх ногами, как летучие мыши. UNED Res. J. 12, e2802. doi: 10.22458 / urj.v12i1.2802

CrossRef Полный текст | Google Scholar

Бенктандер, Дж., Венкатакришнан, В., Падра, Дж. Т., Сунд, Х., Санделл, К., Муруган, А. М. и др. (2019). Влияние размера и географического происхождения на атлантического лосося, Salmo salar , Mucin O-Glycan Repertoire. Мол. Cell Proteomics 18, 1183–1196. doi: 10.1074 / mcp.ra119.001319

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bhat, P. (1995). Ограничивающая роль слизи во всасывании лекарств: проникновение лекарств через раствор слизи. Внутр. J. Pharmaceutics 126, 179–187. doi: 10.1016 / 0378-5173 (95) 04120-6

CrossRef Полный текст | Google Scholar

Bornhöfft, K. F., Goldammer, T., Rebl, A., and Galuska, S. P. (2018). Siglecs: Путешествие через эволюцию лектинов иммуноглобулинового типа, связывающих сиаловую кислоту. Develop. Комп. Иммунол. 86, 219–231. doi: 10.1016 / j.dci.2018.05.008

CrossRef Полный текст | Google Scholar

Челебиоглу, Х. Ю., Ли, С., и Хронакис, И. С. (2020). Взаимодействие муцинов слюны и слюны с пищевыми белками: обзор. Crit. Rev. Food Sci. Nutr. 60, 64–83. doi: 10.1080 / 10408398.2018.1512950

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Серулло, А. Р. (2020). Сравнительная мукомика животных: вдохновение для функциональных материалов из повсеместных и малоизученных биополимеров. ACS Biomater. Sci. Англ. , 6, 5377–5398. doi: 10.1021 / acsbiomaterials.0c00713

PubMed Реферат | CrossRef Полный текст | Google Scholar

Chen, X. , Lee, G. S., Zettl, A., and Bertozzi, C.R. (2004). Биомиметическая инженерия углеродных нанотрубок с использованием миметиков муцина клеточной поверхности. Angew. Chem. Int. Эд. 43, 6111–6116. doi: 10.1002 / anie.200460620

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Co, J. Y., Crouzier, T. и Ribbeck, K.(2015). Исследование роли гликанов, связанных с муцином, в отталкивании бактерий муциновыми покрытиями. Adv. Матер. Интер. 2, 1500179. doi: 10.1002 / admi.201500179

CrossRef Полный текст | Google Scholar

Комба, Ф. Н., Ромеро, М. Р., Гарай, Ф. С., и Баруцци, А. М. (2018). Биосенсор на основе муцина и углеродных нанотрубок для обнаружения глюкозы в плазме человека. Анал. Биохим. 550, 34–40. doi: 10.1016 / j.ab.2018.04.006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Darouiche, R.О. (2004). Лечение инфекций, связанных с хирургическими имплантатами. N. Engl. J. Med. 350, 1422–1429. doi: 10.1056 / nejmra035415

CrossRef Полный текст | Google Scholar

Dhanisha, S. S., Guruvayoorappan, C., Drishya, S., and Abees, P. (2018). Муцины: структурное разнообразие, биосинтез, его роль в патогенезе и возможные терапевтические цели. Crit. Rev. Онкология / гематология 122, 98–122. doi: 10.1016 / j.critrevonc.2017.12.006

CrossRef Полный текст | Google Scholar

Дину, В., МакКалман, Т., Янг, Н., Адамс, Г.Г., Якубов, Г.Э., Хардинг, С.Э. и др. (2020). Исследование влияния ароматических соединений на гидродинамические свойства муцин-гликопротеинов. Eur. Биофиз. J. 49, 799–808. doi: 10.1007 / s00249-020-01475-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дину В., Якубов Г. Э., Лим М., Херст К., Адамс Г. Г., Хардинг С. Э. и др. (2019). Иммобилизация муцина в альгинате кальция: возможное средство миметика слизи для оценки мукоадгезии и сохранения вкуса. Внутр. J. Biol. Макромолекулы 138, 831–836. doi: 10.1016 / j.ijbiomac.2019.07.148

CrossRef Полный текст | Google Scholar

Домингес-Мартин, Э. М., Таварес, Дж., Рихо, П., и Диас-Ланца, А. М. (2020). Зоофармакология: способ открыть новые методы лечения рака. Биомолекулы 10, 1–20. doi: 10.3390 / biom10060817

CrossRef Полный текст | Google Scholar

Датта, Д., Сайлапу, С. К., Саймон, А. Т., Гош, С. С., и Чаттопадхья, А. (2019). Наночастицы муцина, внедренные в золото-нанокластеры, для фотодинамической терапии и биоимиджинга. Langmuir 35, 10475–10483. doi: 10.1021 / acs.langmuir.9b00998

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ekin, İ. (2018). Моллюски: их использование в качестве пищевых продуктов, лекарств, афродизиаков, косметики, ювелирных изделий, каури, жемчуга, аксессуаров и т. Д. От истории до наших дней. mejs 4, 45–51. doi: 10.23884 / mejs.2018.4.1.06

CrossRef Полный текст | Google Scholar

Ellijimi, C., Ben Hammouda, M. , Othman, H., Moslah, W., Jebali, J., Mabrouk, H.B., et al. (2018). Слизь Helix Aspersa Maxima проявляет антимеланогенное и противоопухолевое действие в отношении клеток меланомы. Биомед. Фармакотер. 101, 871–880. doi: 10.1016 / j.biopha.2018.03.020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Etim, L., Aleruchi, C., and Obande, G. (2016). Антибактериальные свойства слизи улитки на бактерии, выделенные от пациентов с раневой инфекцией. Британский журнал микробиологических исследований 11, 1–9. doi: 10.9734 / bmrj / 2016/21731

CrossRef Полный текст | Google Scholar

Фассио, Г., Модика, М. В., Мэри, Л., Захариас, П., Федосов, А. Е., Горсон, Дж., И др. (2019). Разнообразие и эволюция ядов у самого расходящегося рода конусных улиток Profundiconus. Токсины (Базель) 11 (11), 623. doi: 10.3390 / toxins11110623

PubMed Реферат | CrossRef Полный текст | Google Scholar

Гало Силва, Г., Валенте, М. Л. Д. К., Бахманн, Л., и дос Рейс, А. С. (2019). Использование полиэтилентерефталата в качестве компонента протеза в протезе на имплантате съемного протеза. Mater. Sci. Англ. С 99, 1341–1349. doi: 10.1016 / j.msec.2019.01.136

CrossRef Полный текст | Google Scholar

Gargano, A. F. G., Lämmerhofer, M., Lönn, H., Schoenmakers, P. J., and Leek, T. (2014). Стационарные фазы на основе муцина как инструмент для характеристики взаимодействия лекарств и слизи. J. Chromatogr. А 1351, 70–81. doi: 10.1016 / j.chroma.2014.05.031

CrossRef Полный текст | Google Scholar

Джентили, В., Бортолотти, Д., Бенедуси, М., Алогна, А., Fantinati, A., Guiotto, A., et al. (2020). HelixComplex Snail Mucus как потенциальная технология против повреждения кожи, вызванного O3. PLoS One 15, e0229613. doi: 10.1371 / journal.pone.0229613

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гердол, М. (2017). Иммунологические гены у брюхоногих и двустворчатых моллюсков: сравнительный обзор. Invertebr. Выжить. J. 14, 103–118.

Google Scholar

Горсон, Дж., Рамраттан, Г., Вердес, А., Райт, Э.М., Кантор Ю., Раджарам Сринивасан Р. и др. (2015). Молекулярное разнообразие и эволюция генов ядовитого арсенала теребридных хищных морских улиток. Genome Biol. Evol. 7, 1761–1778. doi: 10.1093 / gbe / evv104

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Gould, J., Valdez, J. W., and Upton, R. (2019). Выделения слизи адгезивной защиты в слизняке красного треугольника (Triboniophorus Graeffei) могут вывести из строя взрослых лягушек. Этология 125, 587–591.doi: 10.1111 / eth.12875

CrossRef Полный текст | Google Scholar

Гугу, Т. Х., Онвусоба, Р. К., Оньи, П. Н. и Оциоко, А. С. (2020). Синергетическое взаимодействие природного муцина улитки и линкомицина для иммунохимиотерапии против стрептопневмококковой инфекции: оценки шахматной доски. Внутр. J. Pharm. Вкладывать деньги. 10, 379–383. doi: 10.5530 / ijpi.2020.3.67

CrossRef Полный текст | Google Scholar

Гильен-Поза, П. А., Санчес-Фернандес, Э. М., Артигас, Г., Гарсия Фернандес, Дж. М., Хиноу, Х., Ортис Меллет, К. и др. (2020). Усиленное определение аутоантител к раку молочной железы с использованием миметиков Tn-антигена на основе MUC1. J. Med. Chem. 63, 8524–8533. doi: 10.1021 / acs.jmedchem.0c00908

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хаймс, С. Р., Стром, Э. А., и Файф, К. (2006). Лучевой дерматит: клиническая картина, патофизиология и лечение, 2006. J. Am. Акад. Дерматол. 54, 28–46. DOI: 10.1016 / j.jaad.2005.08.054

CrossRef Полный текст | Google Scholar

Игучи, С. М., Айкава, Т., и Мацумото, Дж. Дж. (1982). Антибактериальная активность муцина слизи улитки. Комп. Биохим. Physiol. A: Physiol. 72, 571–574. doi: 10.1016 / 0300-9629 (82) -2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Jain, C. , Rhie, A., Zhang, H., Chu, C., Walenz, B.P., Koren, S., et al. (2020). Взвешенная выборка минимизатора улучшает отображение при длительном считывании. Биоинформатика 36, i111 – i118. doi: 10.1093 / биоинформатика / btaa435

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Джавитт, Г., Кальво, М. Л. Г., Альберт, Л., Резник, Н., Илани, Т., Дискин, Р., и др. (2019). Кишечные гелеобразующие муцины полимеризуются посредством дисульфидной димеризации доменов D3. J. Mol. Биол. 431, 3740–3752. doi: 10.1016 / j.jmb.2019.07.018

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кабакамбира, Дж.Д., Хатегека, К., Пейдж, К., Нтиренганья, К., Дусабеджамбо, В., Ндоли, Дж. И др. (2018). Эффективность схем ликвидации Helicobacter pylori в Руанде: рандомизированное контролируемое исследование. BMC Gastroenterol. 18, 134. doi: 10.1186 / s12876-018-0863-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Краснова, Л. , и Вонг, С.-Х. (2016). Понимание химии и биологии гликозилирования с синтезом гликанов. Annu. Rev. Biochem. 85, 599–630.doi: 10.1146 / annurev-biochem-060614-034420

PubMed Реферат | CrossRef Полный текст | Google Scholar

Ланг, Т., Классон, С., Ларссон, Э., Йоханссон, М. Е. В., Ханссон, Г. К., и Самуэльссон, Т. (2016). Поиск эволюционного происхождения белковых компонентов эпителиальной слизи — муцинов и FCGBP. Мол. Биол. Evol. 33, 1921–1936. doi: 10.1093 / molbev / msw066

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лим, В. З., Йонг, А. А., Тан, В. П.М., Чжао, X., Витале, М., и Го, К. Л. (2020). Эффективность и безопасность нового космецевтического режима на основе комбинации фильтрата секрета улитки и экстракта яиц улитки для улучшения признаков старения кожи. J. Clin. Эстет. Дерматол. 13, 31–36.

PubMed Аннотация | Google Scholar

Линден, С. К., Саттон, П., Карлссон, Н. Г., Королик, В., и Макгукин, М. А. (2008). Муцины в слизистой оболочке, препятствующей инфицированию. Mucosal Immunol. 1, 183–197. DOI: 10,1038 / ми.2008.5

PubMed Реферат | CrossRef Полный текст | Google Scholar

Lodi, M., Staikou, A., Janssen, R., and Koene, J.M. (2017). Высокий уровень конкуренции сперматозоидов может увеличить передачу продуктов добавочных желез, переносимых любовным дротиком наземных улиток. Ecol. Evol. 7, 11148–11156. doi: 10.1002 / ece3.3385

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Martins, M. D. F., Caetano, F. A. M., Sírio, O. J., Yiomasa, M. M., Mizusaki, C. I., and Figueiredo, L.Д. (2003). Avaliação macro e microscópica da cicatrização de lesões experimentalmente provocadas em pele de coelhos tratadas com secretção mucoglicoproteica Do escargot Achatina fulica . Braz. J. Vet. Res. Anim. Sci. 40, 213. doi: 10.1590 / s1413-95962003000

9

CrossRef Полный текст | Google Scholar

А. Майкл (редактор) (2012). «Разнообразные возможности биополимеров тропических животных в доставке лекарств: уроки муцина африканской улитки», Биополимеры в доставке лекарств: последние достижения и проблемы (Шарджа, ОАЭ: BENTHAM SCIENCE PUBLISHERS), 27–38.doi: 10.2174 / 978160805078910

0027

CrossRef Полный текст | Google Scholar

Михеенко А., Бзикадзе А. В., Гуревич А., Мига К. Х., Певзнер П. А. (2020). TandemTools: отображение длинных считываний и оценка / улучшение качества сборки в сверхдлинных тандемных повторах. Март Наркотики 17, i75 – i83. doi: 10.1093 / bioinformatics / btaa440

CrossRef Полный текст | Google Scholar

Momoh, M. A., Akpa, P. A., Ugwu, K. C., Kenechukwu, F. C., and Kenneth, O.C.(2020). Фармакодинамика и поведение фармакокинетики инсулина из микрочастиц ПЭГилированного муцина, покрытых чувствительным к pH полимером: получение и характеристика. Mater. Сегодня общ. 25, 101539. doi: 10.1016 / j.mtcomm.2020.101539

CrossRef Полный текст | Google Scholar

Momoh, M. , Adedokun, M., Adikwu, M., and Ibezim, C. (2014). In vitro. оценка матрицы ПЭГилированного муцина в качестве носителя для пероральной доставки гидрохлорида метформина. Trop.J. Pharm. Res. 13, 1039–1045. doi: 10.4314 / tjpr.v13i7.5

CrossRef Полный текст | Google Scholar

Mu, A., Okolie, C.O., and Agboke, A. (2008). Влияние муцина улитки на скорость заживления язвы кларитромицином. J. Pharm. Res. 8, 6. doi: 10.18579 / jpcrkc / 2009/8/1/79523

CrossRef Полный текст | Google Scholar

Mumuni, M. A., Kenechukwu, F. C., Ofokansi, K. C., Attama, A. A., and Díaz, D. D. (2020). Мукоадгезивные наночастицы с инсулином на основе комплексов муцин-хитозан для пероральной доставки и лечения диабета. Carbohydr. Polym. 229, 115506. doi: 10.1016 / j.carbpol.2019.115506

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Наварро, Л. А., Френч, Д. Л., и Заушер, С. (2018). Достижения в синтезе миметиков муцина и его применении в науке о поверхности. Curr. Opin. Коллоид Интерф. Sci. 38, 122–134. doi: 10.1016 / j.cocis.2018.09.004

CrossRef Полный текст | Google Scholar

Nguyen, J. K., Masub, N., and Jagdeo, J. (2020). Биоактивные ингредиенты в корейских космецевтиках: тенденции и данные исследований. J. Cosmet. Дерматол. 19, 1555–1569. doi: 10.1111 / jocd.13344

CrossRef Полный текст | Google Scholar

Перес-Вилар, Дж. И Хилл, Р. Л. (1999). Структура и сборка секретируемых муцинов. J. Biol. Chem. 274, 31751–31754. doi: 10.1074 / jbc.274.45.31751

CrossRef Полный текст | Google Scholar

Питт, С. Дж., Грэм, М. А., Деди, К. Г., Тейлор-Харрис, П. М., и Ганн, А. (2015). Антимикробные свойства слизи бурой садовой улитки Helix Aspersa. Br. J. Biomed. Sci. 72, 174–181. doi: 10.1080 / 09674845.2015.11665749

CrossRef Полный текст | Google Scholar

Pushpass, R.-A. Г., Пелличчотта, Н., Келли, К., Проктор, Г., и Карпентер, Г. Х. (2019). Снижение связывания муцина в слюне и гликозилирования у пожилых людей влияет на вкус в модели клеток In vitro . Питательные вещества 11, 2280. doi: 10.3390 / nu11102280

PubMed Реферат | CrossRef Полный текст | Google Scholar

Pushpass, R.Г., Дейли Б., Келли К., Проктор Г. и Карпентер Г. Х. (2019). Изменение слюноотделения, белкового состава и реологии после стимуляции вкуса и TRP у пожилых людей. Фронт. Physiol. 10, 652. doi: 10.3389 / fphys.2019.00652

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Sandberg, T., Karlsson Ott, M., Carlsson, J., Feiler, A., and Caldwell, K. D. (2009). Возможное использование муцинов в качестве покрытий из биоматериалов. II. Муциновые покрытия влияют на конформацию и активирующие нейтрофилы свойства адсорбированных белков-хозяев в направлении имитатора слизистой оболочки. J. Biomed. Матер. Res. 91A, 773–785. doi: 10.1002 / jbm.a.32315

CrossRef Полный текст | Google Scholar

Santana, W. A., Melo, C. M. d., Cardoso, J. C., Pereira-Filho, R. N., Rabelo, A. S., Reis, F. P., et al. (2012). Оценка антимикробной активности и лечебного потенциала слизистого секрета Achatina fulica . Внутр. J. Morphol. 30, 365–373. doi: 10.4067 / s0717-95022012000200001

CrossRef Полный текст | Google Scholar

Sompayrac, L.М. (2012). Как работает иммунная система . 4-й Editio.

Google Scholar

Ван Путтен, Дж. П. М. и Стрижбис, К. (2017). Трансмембранные муцины: сигнальные рецепторы на пересечении воспаления и рака. J. Врожденный иммунитет. 9, 281–299. doi: 10.1159 / 000453594

CrossRef Полный текст | Google Scholar

Ян, Х., Хьорт, М., Винкельянн, Б., Добрыден, И., Лилег, О., и Крузье, Т. (2020). Гликомодификация гидрогелей муцина для исследования их иммунной активности. ACS Appl. Матер. Интер. 12, 19324–19336. doi: 10.1021 / acsami.0c03645

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Белок и летучие компоненты слизи тропической улитки обыкновенной садовой, Cornu aspersum

% PDF-1. 6 % 1 0 объект > поток DOI: 10.1371 / journal.pone.0251565

  • Кайлин Р. Баллард, Энн Х. Кляйн, Ричард А. Хейс, Тианфанг Ван, Скотт Ф. Камминс
  • Белок и летучие компоненты слизи обыкновенной садовой улитки Cornu aspersum
  • 10.1371 / journal.pone.0251565 http://dx.doi.org/10.1371/journal.pone.02515652021-05-27false10.1371/journal.pone.0251565
  • www.plosone.org
  • 10.1371 / journal.pone.02515652021-05-27false
  • www.plosone.org
  • конечный поток эндобдж 2 0 obj > эндобдж 5 0 объект > / ProcSet 12 0 R / XObject >>> эндобдж 6 0 объект [14 0 R 15 0 R 16 0 R 17 0 R 18 0 R 19 0 R 20 0 R 21 0 R 22 0 R 23 0 R 24 0 R 25 0 R 26 0 R 27 0 R 28 0 R 29 0 R 30 0 R 31 0 R 32 0 R 33 0 R 34 0 R 35 0 R 36 0 R 37 0 R 38 0 R 39 0 R 40 0 ​​R 41 0 R 42 0 R 43 0 R 44 0 R] эндобдж 14 0 объект > / Граница [0 0 0] >> эндобдж 15 0 объект > / Граница [0 0 0] >> эндобдж 16 0 объект > / Граница [0 0 0] >> эндобдж 17 0 объект > / Граница [0 0 0] >> эндобдж 18 0 объект > / Граница [0 0 0] >> эндобдж 19 0 объект > / Граница [0 0 0] >> эндобдж 20 0 объект > / Граница [0 0 0] >> эндобдж 21 0 объект > / Граница [0 0 0] >> эндобдж 22 0 объект > / Граница [0 0 0] >> эндобдж 23 0 объект > / Граница [0 0 0] >> эндобдж 24 0 объект > / Граница [0 0 0] >> эндобдж 25 0 объект > / Граница [0 0 0] >> эндобдж 26 0 объект > / Граница [0 0 0] >> эндобдж 27 0 объект > / Граница [0 0 0] >> эндобдж 28 0 объект > / Граница [0 0 0] >> эндобдж 29 0 объект > / Граница [0 0 0] >> эндобдж 30 0 объект > / Граница [0 0 0] >> эндобдж 31 0 объект > / Граница [0 0 0] >> эндобдж 32 0 объект > / Граница [0 0 0] >> эндобдж 33 0 объект > / Граница [0 0 0] >> эндобдж 34 0 объект > / Граница [0 0 0] >> эндобдж 35 0 объект > / Граница [0 0 0] >> эндобдж 36 0 объект > / Граница [0 0 0] >> эндобдж 37 0 объект > / Граница [0 0 0] >> эндобдж 38 0 объект > / Граница [0 0 0] >> эндобдж 39 0 объект > / Граница [0 0 0] >> эндобдж 40 0 объект > / Граница [0 0 0] >> эндобдж 41 0 объект > / Граница [0 0 0] >> эндобдж 42 0 объект > / Граница [0 0 0] >> эндобдж 43 0 объект > / Граница [0 0 0] >> эндобдж 44 0 объект > / Граница [0 0 0] >> эндобдж 45 0 объект > эндобдж 3 0 obj > поток х \ [и. ) nXIre _ ‘%% 䪬 fH8, Ū | O = TqiїsΥY0 / Y0 ϒ (‘ e6d5> (- C {: Ys2t’4.ʲyv \ fE9 (gE_8 / IGEfNlG ~ q8Mqq`E

    >! 7qiͳR & {L pd `Ӥ4 ECYu y_, ΣDJ̌LX8E2pR2 $ LƠl1B» | nt? Ӈ6XBl46 + (_dF0! (_L | &) / t ~ W / f20) ~ ʏNĭ3cw $ A4S ~ A0O3YIsraeVq / v $ iGF 7 [BvXT% TtFs I, Cb۳p_a ۂ

    IN VITRO ВЛИЯНИЕ СМЕСИ ИЗ МАНТИИ СОВМЕСТИМЫХ (LYMNAEA ELODES) И НЕСОВМЕСТИМЫХ (HELISOMA TRIVOLVIS) УЛИТКОВ НА FASCIOLOIDES MAGNAOR MIRACIDIA Абстрактный

    Эпидермальная слизь, покрывающая поверхность улитки, представляет собой важный барьер для личинок трематод, пытающихся проникнуть в улитку, и может играть роль в обеспечении совместимости улиток с трематодами.В этом исследовании Facioloides magna miracidia подвергались воздействию слизи, полученной от совместимой улитки-хозяина Lymnaea elodes (palustris) и несовместимой улитки Helisoma trivolvis. Обработка только что вылупившихся мирацидиев in vitro слизью, полученной из улиток, оказывала совершенно разные эффекты на личинок в зависимости от вида улиток. При самом низком разведении слизи (1: 3) средние показатели повреждения (повреждение тегументации и / или лизис и гибель личинок) достигли 100% для мирацидий, подвергшихся воздействию слизи H. trivolvis, в то время как ни один из F.magna miracidia были повреждены в слизи L. elodes. Для характеристики компонента (компонентов) слизи, вызывающего наблюдаемые морфологические изменения, были выполнены серии разведений для каждого вида улиток и обработки теплом и протеиназой K. Повреждающее действие слизи H. trivolvis зависело от концентрации и полностью устранялось нагреванием (65 ° C, 30 мин) и обработкой протеиназой, в значительной степени вовлекая термолабильный белок (-ы) в слизи в качестве активного цитотоксического агента (-ов). В отличие от нашего прогноза, контакт мирацидий со слизью совместимого L.elodes запускали личиночную трансформацию, слизь любого из протестированных видов улиток практически не проявляла активности. В целом эти данные демонстрируют присутствие мощного цитотоксического протеиноподобного фактора в слизи F. magna — несовместимого H. trivolvis и его отсутствие в слизи совместимой улитки L. elodes. Это открытие подтверждает мнение о том, что слой эпидермальной слизи может служить важным определяющим фактором совместимости личинок трематод и улиток.

    Информация о журнале

    Журнал паразитологии — официальное издание Американского общества паразитологов (ASP).Он издается непрерывно с 1914 года, когда его основал Генри Болдуин Уорд. Журнал специализируется на общей паразитологии, а также на паразитах, имеющих медицинское, ветеринарное и экономическое значение. Основное внимание уделяется эукариотическим паразитам, хотя векторы для прокариотических организмов и вирусы также включены. Журнал печатается в издательстве Allen Press в Лоуренсе, штат Канзас, шесть раз в год. Доступны институциональные подписки. Членство в ASP включает получение журнала Parasitology, ежеквартального информационного бюллетеня и выдержек из ежегодных собраний; студенты могут присоединиться по значительно сниженной ставке. Журнал находится в сети через BioOne. Редактором журнала является д-р Майкл В.К. Сухдео. Для получения дополнительной информации о публикации в журнале обращайтесь в редакцию журнала по адресу [email protected] Для получения информации о членстве в ASP свяжитесь с обществом: http://amsocparasit.org/. Для получения информации о подписке обращайтесь на [email protected]

    Информация об издателе

    Allen Press играет жизненно важную роль в распространении знаний и информации. путем партнерства с организациями в научном, техническом и медицинском сообществе продвигать свои интересы и добиваться поставленных целей.Штаб-квартира в Лоуренсе, KS, Allen Press предоставляет полный спектр интегрированных услуг в широкие области управления контентом, онлайн-доставка и печать, ассоциация менеджмент и издательские услуги. Allen Press — надежный партнер научных общества, профессиональные ассоциации и корпорации по всей стране.

    ЭФФЕКТИВНОСТЬ СЛИВА УЛИТКОВ (ACHATINA FULICA) И ХИТОЗАНА В СОДЕРЖАНИИ РАСПРОСТРАНЕНИЯ ЛИМФОЗИТА В VITRO

    Роббинс К.Учебник патологии. Проблема. 7, т. 1. Джакарта: Книжные медицинские издательства EGC; 2007.

    Harti AS, Haryati DS, Setyaningsih WS, Yatmihatun S. Потенциальный хито-олигосахарид (COS) в качестве природного пребиотика и консерванта синбиотического тофу в Индонезии. Int J Pharm Med Biol Sci 2015; 4: 204-8.

    Берниянти Т., Суварно Б. Характеристика изолята белка слизи улитки (ахазина) как местного антибактериального фактора. J Vet Media 2007; 23: 139 44.

    Депамеде С., Росииди А.Подавление пролиферации лимфоцитов Balb / c экстрактом семенников балийской кисты: роль TGF-². Livestock Media 2009; 2009: 95-103.

    Моссманн, Т. Экспресс-колориметрический анализ клеточного роста и выживаемости: применение для анализов пролиферации и цитотоксичности. J. Immunol. Методы 1983; 65: 55-63.

    Ян З., Сюн HR. Условия культивирования и типы питательных сред для клеток млекопитающих. В: Nelli LC, Matteoli E, редакторы. Биомедицинская культура тканей.Хорватия: Intech Publisher, Open Acsess Company; 2012. с. 11.

    Maciver NJ, Jacobs SR, Wieman HL, Wofford JA, Coloff JL, Rathmell JC и др. Метаболизм глюкозы в лимфоцитах — это регулируемый процесс, существенно влияющий на функцию и выживаемость иммунных клеток. Журнал J Leukoc Biol 2008; 84: 949-57.

    Харти А.С., Нурхидаяти А., Хандаяни Д., Кусумавати Н.Н., Харьяти Д.С. Темпе обогащения хитозана из рисовых отрубей в качестве функциональной пищевой антигиперхолестеринемии в Индонезии.Int J Biosci Biochem Bioinform 2014; 4: 423-7.

    Харти А.С., Нурхидаяти А., Хандаяни Д. Потенциал рисовых отрубей и хитоолигосахарида в качестве природного пребиотика в традиционном темпе в Индонезии. Int J Biosci Biochem Bioinform 2013; 3: 654-6.

    Vieira TC, Costa-Filho A, Salgado NC, Allodi S, Valente AP, Nasciutti LE, et al. Сульфат ачарана, новый гликозаминогликан из Achatina fulica Bowdich 1822. Структурная неоднородность, метаболическая маркировка и локализация в организме, слизи и матриксе органической оболочки.Eur J Biochem 2004; 271: 845-54.

    Перес В.П., Дина Ф., Иванг Ю. Эффект слизи улитки (Achatina fulica) против общих фибробластов клеток на заживляющую рану кожи мышей (Mus musculus). Журнал J Vet Med Sci Health 2012; 4: 195-203.

    Али ГП. Быстрый сравнительный тест на заживление сетчатой ​​раны у кролика Lepus negricollis (negricollis) между введением 10% раствора повидона йода и слизи улитки (Achatina fulica). Диссертация, медицинский факультет Университета Тандулако; 2009 г.

    Zulaechah S. Разница между заживлением ран Sayat Speed ​​с использованием слизи улитки (Achatina fulica) с 10% повидон-йодом при лечении ран у мышей (Mus musculus). Джокьякарта: диссертация, факультет медицины и медицинских наук, Университет Мухаммадии; 2010.

    Harti AS, Sulisetyawati SD, Murharyati A, Oktariani M, Wijayanti IB. Эффективность слизи улитки и хитозана при заживлении ран. Int J Pharm Med Biol Sci 2016; 5: 76-80.

    Kozier B, Taylor CR.Основы сестринского дела. 7-е изд. Нью-Джерси: Education Inc .; 2004. с. 856-62.

    Мандала AP, Агнес Ш. Предоставление 100% слизи улитки (Achantina fulica) и 5% крема для длительного заживления ран (степень а) in vivo. Суракарта: Заключительный отчет, Отделение Сестринского дела, Школа медицинских наук Кусума Хусада Суракарта; 2014.

    Johnson KE. Краткий обзор гистологии и клеточной биологии. Южный Тангеранг: Бинарупа Паблишинг; 2011.

    Гигантская африканская наземная улитка во Флориде

    Джон Л.Capinera

    Коллекция Featured Creatures содержит подробные профили насекомых, нематод, паукообразных и других организмов, имеющих отношение к Флориде. Эти профили предназначены для использования заинтересованными непрофессионалами с некоторыми знаниями биологии, а также академической аудиторией.

    Гигантская африканская наземная улитка Achatina (Lissachatina) fulica , по мнению некоторых, одна из самых вредных улиток в мире. Было замечено, что он питается по крайней мере 500 различными типами растений, многие из которых являются зерновыми.Считается, что он возник в Восточной Африке, но с тех пор распространился по многим странам Юго-Восточной Азии и островам в Тихом океане, включая Гавайские острова. Совсем недавно этот моллюск попал в Южную Америку (Бразилия) и на Карибские острова Мартиника, Гваделупа, Сент-Люсия, Барбадос и Сен-Мартен / Сен-Мартен. В начале сентября 2011 года его нашли в округе Майами-Дейд на юге Флориды. Это не первое появление гигантской африканской улитки во Флориде. В 1966 году ребенок из Майами, штат Флорида, переправил трех гигантских африканских улиток на юг Флориды, когда вернулся из поездки на Гавайи.В конце концов его бабушка выпустила улиток в свой сад. Семь лет спустя было найдено более 18 000 улиток и множество яиц. В конечном итоге он был ликвидирован, но на уничтожение этого захватчика потребовалось 10 лет и заплатил 1 миллион долларов. Флорида снова столкнулась с нашествием этой улитки.

    Описание

    Гигантская африканская наземная улитка вырастает до больших размеров. Он может достигать длины почти 8 дюймов (20 см) и диаметра 5 дюймов (13 см). Он имеет коническую форму, сужающийся к определенной точке на одном конце, но закругленный на другом (рис. 1).Несмотря на разный внешний вид, эта улитка обычно светло-коричневая с темно-коричневыми полосами (рис. 2).

    Рисунок 1. Гигантская африканская наземная улитка.
    Кредит: Х. Ли.

    Рисунок 2. Гигантская африканская наземная улитка.
    Кредит: Б. Франк.

    Как и другие улитки, гигантская африканская наземная улитка имеет мясистое тело, которое можно вставить в раковину. На нем две пары щупалец. У более крупных, верхних пар есть глаза на концах. Он скользит на длинной мускулистой «ступне», которая выдавливает смазку в виде слизи.

    Поведение

    Гигантские африканские улитки наиболее распространены в неестественных (нарушенных) областях, таких как сады. Обычно у них есть место для дневного отдыха, а ночью они бродят, чтобы покормиться. Взрослые особи часто возвращаются к месту отдыха утром, но у неполовозрелых улиток вероятность этого меньше. Они могут преодолевать расстояние до 50 футов (1500 см) за одну ночь, чтобы покормиться. Как и другие улитки, они в основном активны ночью и в сырую погоду (относительная влажность выше 50%). По пути они оставляют след слизи (слизи).Обычно они ищут затененные, защищенные места для отдыха с высокой влажностью, но могут лазить по деревьям и стенам, чтобы отдохнуть. В ненастную и сухую погоду они становятся малоподвижными, и это состояние называется праздником. Они часто ищут влажную почву в качестве места для отдыха, вероятно, для поддержания влажности тела, потому что они не питаются во время отдыха. Во время гестации они могут покрывать отверстие своей раковины твердым покровом (называемым эпифрагмой). Они могут оставаться в этом состоянии покоя в течение нескольких месяцев, ожидая более благоприятной погоды.

    Улитки — гермафродиты, что означает, что они содержат как женские, так и мужские репродуктивные органы. Хотя каждая улитка содержит как мужские, так и женские органы, они редко самооплодотворяются; вместо этого они спариваются с другим человеком. Во время спаривания оба человека сдают и принимают сперму одновременно. Как и большинство других форм поведения, спаривание обычно происходит ночью. Отложение яиц происходит через 1–3 недели после спаривания, но затем может продолжаться более года. После спаривания каждая улитка может произвести около 100 яиц в течение первого года жизни, а затем 200–1000 на второй год.Яйца имеют твердую оболочку, их диаметр составляет 1 / 6–1 / 5 дюйма (4,5–5,5 мм), и они откладываются в почве. Несвязанные улитки производят мало яиц. Яйца обычно производятся в начале сезона дождей и снова в конце.

    После вылупления молодые улитки обычно потребляют свою яичную скорлупу и органические вещества в почве, оставаясь в ней в течение 1-2 недель, прежде чем выкапываются на поверхность и питаются разлагающимися растительными веществами (детритом) и подходящими живыми растениями. Первоначально они остаются рядом с местом вылупления, но со временем начинают рассеиваться дальше в поисках пищи.Интересно, что их диетические привычки меняются по мере взросления. Более старые и крупные улитки с меньшей вероятностью будут питаться живыми растениями, чем особи среднего возраста, вместо этого они будут питаться детритом, таким как опавшие листья и разлагающийся растительный материал.

    Эти улитки активны в диапазоне температур примерно 48–90 ° F (9–32 ° C), но могут выжить как при более низких, так и при более высоких температурах, иногда зарываясь в почву. Основываясь на их распространении в других местах, считается, что гигантская африканская улитка может выжить на севере до 40 градусов широты, включая такие районы, как Нью-Джерси и Колорадо.

    Возможный урон

    Несмотря на подтвержденную документально способность питаться сотнями различных растений, можно ожидать, что гигантская африканская улитка нанесет наибольший ущерб овощам, цветам и другим декоративным растениям, а также однолетним сорнякам. Однако в опасности любое суккулентное растение, особенно рассада. Необходимость изменить методы выращивания или контролировать этих улиток, когда они приживутся, создает дополнительное экономическое бремя.

    Гигантская африканская улитка также оказалась вредной для здоровья, передавая болезнетворные организмы растениям и животным, включая людей.Он может служить промежуточным хозяином для легочного червя крысы, который может вызвать менингоэнцефалит у человека. Он также является переносчиком грамотрицательной бактерии Aeromonas hydrophila , вызывающей несколько симптомов заболевания у людей, особенно с ослабленной иммунной системой.

    Менеджмент

    Улитки предпочитают повышенную влажность. Следовательно, устранение мульчи, почвенного покрова и другой густой растительности, древесины и камней лишит их влажной, укрывающей среды. Уменьшение количества полива также может лишить их влажной среды, которую они предпочитают.Наблюдение за растениями в ночное время может выявить присутствие мародерствующих улиток даже там, где нет никаких признаков их присутствия в дневное время. Улитки, как правило, не отходят далеко от своих растений-хозяев, поэтому, если повреждения заметны, скорее всего, улитка находится поблизости.

    Улитки восприимчивы к ловушкам. Доска, блюдце для цветочного горшка или неглазурованный цветочный горшок, помещенные в тенистое место, могут служить очень подходящим убежищем для улиток, а затем злоумышленников можно собрать вручную в светлое время суток из-под убежища и уничтожить .Гигантских африканских улиток особенно привлекают бананы и плоды папайи, поэтому их можно использовать в качестве приманки для их привлечения.

    Улитки часто бывают достаточно большими, чтобы их было легко увидеть, поэтому их можно собирать вручную. Чтобы подбирать улиток, важно надевать перчатки или использовать орудие, поскольку некоторые улитки могут переносить болезни, передаваемые человеку через прикосновение. Если вы собираете улиток, вы можете убить их, запечатав их в полиэтиленовый пакет, а затем поместив его в морозильную камеру на ночь. Министерство сельского хозяйства и бытового обслуживания Флориды и Министерство сельского хозяйства США в настоящее время проводят гигантскую программу уничтожения африканских наземных улиток в округе Майами-Дейд, чтобы выявить и удалить собранных улиток.С ними можно связаться по горячей линии 888-397-1517.

    Барьеры также могут быть полезны для минимизации ущерба от улиток. Считается, что медная фольга и экран вступают в реакцию со слизью моллюсков, создавая электрический ток, который удерживает их от пересечения барьера. Ноги тепличных скамеек или стволы деревьев, например, можно окаймить медными полосами, чтобы эти животные не переходили дорогу. Медную фольгу, разработанную специально для сдерживания движения моллюсков, можно приобрести в магазинах садовых товаров и в каталогах.Хотя внедрение и дорого обходится, медь можно использовать для окольцовывания целых садов, чтобы предотвратить вторжение моллюсков. Однако медная полоса со временем окисляется, становясь менее эффективной. Точно так же диатомовую землю можно посыпать вокруг сада или грядки, чтобы исключить моллюсков, поскольку они не любят ползать по этому абразивному материалу в виде частиц. Однако, как и в случае с медным барьером, он ничего не делает для подавления уже имеющихся, а диатомовая земля легко нарушается дождями и орошением, поэтому лучше всего работает в засушливых условиях.

    Многие препараты моллюскицида доступны для покупки, но почти все они являются продуктами-приманками, содержащими токсичные вещества. Обычно они убивают, заглатывая приманку. Ни один из них не является полностью эффективным, потому что моллюски иногда учатся избегать токсичных веществ или могут выводить токсины из пестицидов, восстанавливаясь после сублетального отравления. Хорошей практикой является применение приманки после того, как участок поливается или орошается, поскольку вода стимулирует активность моллюсков, увеличивая вероятность того, что приманки будут съедены.Однако нельзя поливать сразу после применения приманки. Приманки можно использовать для разбрасывания в садах, в которых есть уязвимые растения, или вокруг них. Лучше всего разбросать материал приманки, так как это снизит вероятность того, что домашние животные или позвоночные животные найдут и съедят большую часть токсичной приманки и заболеют или погибнут.

    Приманки, содержащие металлдегид, давно используются и остаются доступными. Несмотря на то, что эффективные составы, содержащие метальдегид, довольно токсичны для домашних животных и диких животных, необходимо соблюдать осторожность при применении этого токсичного вещества.Кроме того, рекомендуется избегать заражения съедобных растений, таких как овощи, приманкой, содержащей металлдегид.

    Есть альтернативы метальдегиду. Некоторые продукты, содержащие моллюскициды, включают пестициды карбамата (отдельно или в сочетании с метальдегидом), так как они также могут быть токсичными для моллюсков. Новые приманки для моллюсков могут содержать альтернативный токсикант: фосфат железа. Фосфат железа намного безопаснее, чем метальдегид и / или карбаматы, для использования с домашними животными и позвоночными животными, а также эффективен.Другие составы приманок содержат борную кислоту как токсикант. Хотя приманки, содержащие борную кислоту, еще не полностью проверены, они кажутся многообещающими для борьбы с гигантскими африканскими улитками. Независимо от токсичного вещества, приманки следует рассыпать тонкими слоями внутри и вокруг растительности, чтобы предотвратить попадание слишком большого количества приманки в организм домашних или диких животных.

    Дополнительная информация

    Giant African Snails, Расширенные решения UF / IFAS для вашей жизни: https://sfyl.ifas.ufl.edu/archive/hot_topics/environment/giant_african_snail.shtml

    Гигантская африканская наземная улитка, FDACS-DPI: https://www.fdacs.gov/Agriculture-Industry/Pests-and-Diseases/Plant-Pests-and-Diseases/Giant-African-Land-Snail

    Произошла ошибка при установке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *