Маиза из клона: Маиза из «Клона» стала бабушкой

Содержание

Сериал «Клон»- зачем Маиза выбрала Лукаса+ мудрая цитата дяди Али | Ностальгия по СССР

Помните то замечательное время, когда по вечерам мы бежали к телевизору, чтобы посмотреть очередную серию «Клона»? До него транслировались и другие бразильские и аргентинские сериалы. И знаете, они были интересными. Глупо, наверное, но мне их не хватает. На смену жарким пляжам и аргентинским танго пришли наши «долгоиграющие» сериалы.

Когда речь заходит о сериале «Клон», то все вспоминают любовный треугольник: Жади-Саид-Лукас. На ум приходят зажигательные восточные танцы, мудрые изречения дяди Али и глупости, которые творила Жади. Всегда было два лагеря: те, кто осуждали Жади. Мол, Саид мужчина-мечта, а она глупенькая. И те, кто наоборот поддерживал героиню.

А мне вспомнилась другая героиня: Маиза. Зачем она выбрала Лукаса? По сюжету Маиза девушка из приличной и обеспеченной семьи. Она встречается с братом-близнецом Лукаса, Диогу.

Симпатичная женщина. ..могла бы устроить свою жизнь иначе, а не превращать «слезы в бриллианты» по ее же собственному выражению.

Симпатичная женщина…могла бы устроить свою жизнь иначе, а не превращать «слезы в бриллианты» по ее же собственному выражению.

Братья абсолютно неразличимы внешне и кардинально отличаются по характеру. Лукас мягкий, романтичный и спокойный. Диогу взрывной, авантюрный, смелый.

Маизе нравились все эти черты в Диогу и они были бы отличной парой. Если бы конечно дело дошло до свадьбы, потому что Диогу менял девушек легко и непринужденно.

Потом Диогу не стало. И Маиза решила произвести замену. Почему нет? Двое из ларца одинаковых с лица. А про характер она забыла. Девушка долго выслушивала рассказы Лукаса про Жади и выбрала самый старый способ сблизиться с мужчиной, она решила стать его подругой. Дальше мы все знаем, свадьба, рождение Мэл.

Маиза прекрасно видела, что Лукас сильно любит Жади. Она видела, что он пытается забыть Жади, но не получается. Решила привязать ребенком? Да, Феррас заставил сына жениться и что? Любви от этого не прибавилось.

Именно поэтому мне непонятны претензии Маизы к Лукасу. Вот я потратила на тебя всю жизнь, а ты любил Жади. Да! Он этого и не отрицал. Маиза сочла факт свадьбы обещанием любви и верности?

Ну, Лукас это конечно «кадр». Пока дождешься его решительных действий…бац…и Жади уже 40 лет

Ну, Лукас это конечно «кадр». Пока дождешься его решительных действий…бац…и Жади уже 40 лет

Нужно было оставить Лукаса в покое. Тем более, что она и сама не сильно любила Лукаса. Спустя время Маиза поняла, что они с братом абсолютно разные.

Всем женщинам стоит взять на заметку одно правило: не нужно привязывать мужчину детьми. Это бесполезно. А еще не нужно строить иллюзий о том, что любовь родится в браке. Это вряд ли. Я даже согласна с тем, что можно прожить всю жизнь с нелюбимым человеком. Можно, но эта жизнь не будет наполнена красками, если только деньгами, в браках по расчету.

Самым мудрым и классным в сериале был дядя Али. Мне вспомнилось его красивое изречение:

Мудрый дядя Али

Мудрый дядя Али

«Море поссорилось с ветром, а пострадала лодка».

Вот это как раз про Маизу и Лукаса. Они наделали ошибок, а страдала от этого дочка.

Стиль Маизы в бразильском сериале «Клон» и в ремейке «Клон-2»: элегантность против откровенности | Кира Сокол / КИНО, ПЕЧЕНЬЕ, ПЛЕД

Привет, поклонники мыльных опер!

Какая героиня из бразильского сериала «Клон», по вашему мнению, самая стильная и утонченная? Лично мне в голову приходит только Маиза Ферраз. Эта женщина всегда следила за трендами – часто посещала с Лидьяной модные показы, покупала дорогие украшения и ни в чем себе не отказывала! А что? Лукас платит, все норм!

Вы уже, наверное, догадались, что речь снова пойдет о сравнении персонажей оригинального «Клон» и мексиканского одноименного ремейка. В оригинале героиню зовут Маиза, в ремейке — Марисса.

Маиза и Марисса. Обе из «Клона», но очень разные

Маиза и Марисса. Обе из «Клона», но очень разные

Сразу хочу заметить, что между этими двумя версиями сериала прошло 9 лет. Всеми нами любимый оригинал вышел в 2001 году, а ремейк – в 2010-м. Поэтому обе героини одевались в соответствии со своим временем.

Поехали!

Маиза (Марисса) в молодости

Клон и Клон-2Это Марисса со своим Лукасом. Ее бывший парень Дьогу только-только отошел на тот свет, а она уже в коротеньком платьице обольщает его братишку.

Помните Маизу в самом начале сериала? Она была скромной и спокойной девушкой. Одевалась довольно просто: рубашки, свитера и легкие закрытые платьица. Марисса из ремейка в первых сериях предстает соблазнительной дамочкой в мини и с глубоким декольте.

Свадебные платья Маизы и Мариссы

Свадебные платья Маизы и Мариссы

Маиза и Марисса хоть и являются героинями одной и той же истории, но характеры и гардеробы у них совершенно разные.

Маиза в зрелости

Маиза из сериала «Клон»

Маиза из сериала «Клон»

Через несколько лет Маиза из оригинального сериала из миленькой скромной девушки перевоплощается в стильную леди.

Маиза из сериала «Клон»

Маиза из сериала «Клон»

В ее гардеробе много крутых вещей, глядя на которые даже спустя 20 лет хочется сказать: «Я тоже такое хочу!».

Основу ее гардероба составляли платья-миди, брючные костюмы, рубашки свободного кроя.
Маиза из сериала «Клон»

Маиза из сериала «Клон»

Эта женщина умела сочетать вещи и аксессуары. Выглядела она всегда утонченно, изящно и уместно.

Марисса в зрелости

Марисса из мексиканской версии «Клон»

Марисса из мексиканской версии «Клон»

Марисса из ремейка «Клона» — дама, предпочитающая исключительно мини. Она любит оголять плечи носить наряды с глубоким декольте. Даже Иветти не одевалась так откровенно, как она!

Марисса из ремейка «Клон»

Марисса из ремейка «Клон»

Татуировки на руках вообще очень забавно смотрятся на этой героине. Несмотря на стиль, разительно отличающийся от оригинала, актриса, играющая в ремейке, очень красива и по-своему хороша в этом сериале.

Маиза и Марисса

Маиза и Марисса

Маиза и Марисса

Итак, героиня одна и та же, а образы у них совершенно разные. Лично мне больше по душе сдержанный и вместе с этим элегантный образ Маизы из оригинального сериала «Клон»

Оригинал и ремейк

Оригинал и ремейк

Марисса из ремейка «Клона» производит впечатление какой-то содержанки богатого папика, нежели супруги тюфячка Лукаса.

Если Маиза надевает короткие платья с открытыми плечами исключительно на светские приемы (и то это всегда платья-миди), то Марисса ходит в своем мини везде: дома, на улице, в гостях и на вечеринках.

Оригинал и ремейк

Оригинал и ремейк

Маиза или Марисса? Чей гардероб вам больше нравится?

А какой стиль для Маизы, по вашему мнению, больше уместен в сюжете сериала «Клон»?

10 главных красавиц-злодеек из сериалов

Коварная Маиза из сериала «Клон», лицемерная Эсмералда из «Берега мечты» и еще 8 самых запоминающихся ролей злодеек.

Даниэла Эскобар (Маиза). Сериал «Клон»

Роль коварной и очень несчастной Маизы – первая большая работа тогда еще начинающей актрисы Даниэлы Эскобар. Персонаж получился неоднозначным: с одной стороны, зрителю было жаль мать наркоманки Мел, у которой не складываются отношения с ее отцом, влюбленным в Жади. С другой, ее интриги и темные дела с Саидом вызывают отвращение и агрессию.

В последних сериях сценаристы все же решили придать Маизе положительный окрас. На сеансе групповой терапии, куда она отвозит дочь, Маиза встречает мужчину с такой же проблемой – его сын страдает от наркозависимости. Она обретает с ним свое женское счастье, осознав, что много лет боролась не за «своего» мужчину (чем закончились ваши любимые сериалы можно узнать тут).

После «Клона» Даниэлу стали приглашать в другие проекты. Своей лучшей работой Эскобар считает роль еврейской девушки Беллы в сериале «Бразильская акварель».

Флавия Алессандра (Кристина). Сериал «Голос сердца»

«Голос сердца» – бразильская теленовелла, вышедшая в 2005 году. У сериала закрученный и небанальный сюжет. По сценарию богатый молодой человек (Рафаэл), занимающийся выведением редких сортов роз, встречает свою настоящую любовь (Луну). После пышной свадьбы у пары рождается ребенок. Можно было бы на этом закончить и показать последнюю серию без надрыва и страданий, если бы в дело не вмешалась злодейка Кристина – двоюродная сестра Луны, влюбленная в ее мужа.

Она настолько ненавидит кузину, что просит молодого преступника Гуту украсть фамильные драгоценности, подаренные Луне после рождения сына. Во время ограбления случился форс-мажор: в комнату зашел Рафаэл. Преступник выстрелил. Луна заслонила собой мужа. Ранение оказалось смертельным и девушка погибает, но ее душа возрождается в теле только что родившейся в индийской деревне Серены.

Несмотря на ангельскую красоту, Кристина – лживая и амбициозная материалистка, для которой не существует преград. Внешность обманчива – сложно оспаривать сей факт!

Летисия Сабателла (Ивони). Сериал «Дороги Индии»

Роль покорной мусульманки и примерной матери Латифы в сериале «Клон» стала одной из самых запоминающихся – имя актрисы до сих пор ассоциируется у зрителя именно с ней. Через несколько лет после окончания этой теленовеллы Летисию пригласили в сериал «Дороги Индии», ставший лауреатом премии «Эмми».

По сюжету молодая девушка Майя влюбляется в представителя низшей касты Бахуана. Ее семья против свадьбы – влюбленные расстаются.

Параллельно создателями повествуется «бразильская» линия. В центре событий – два брата: Рамиру и Раул, борющихся за власть в бизнесе. У них совершенно противоположные характеры. Рамиру – властный, жесткий и деспотичный, Раул – человек, мечтающий о переменах.

В сложный для него период на горизонте появляется Ивони – хитрая и коварная подруга жены, предлагающая ему новую, счастливую жизнь. Девушка, страдающая психическим расстройством, убеждает его развестись, украсть деньги отца и сбежать в другую страну. Вот уж действительно, красота – страшная сила.

Камила Питанга (Эсмеральда). Сериал «Берег Мечты»

Камила Питанга много раз признавалась одной из красивейших актрис бразильских сериалов. В теленовелле, повествующей о жизни маленького рыбацкого городка, затерянного в глуши Бразилии, ей досталась роль Эсмеральды – девушки, безответно влюбленной в главного героя.

Ради своих чувств она готова пойти на все, даже на подлость. Красивая, стройная и, на первый взгляд, нежная и милая, Эсмеральда на самом деле лицемерная и лживая. Ей нравится купаться во внимании мужчин и манипулировать людьми. Она даже притворяется подругой своей соперницы, исподтишка делая ей гадости. На что только не способны женщины ради любви.

Мариана Ариас (Андреа). Сериал «Дикий ангел»

 

Мили воспитывалась в церковном приходе. В 18 лет девушка, лихо играющая в футбол и получившая прозвище Чолито, устраивается домработницей в семью Федерико Ди Карло, члены которой только и делают, что ругаются между собой. Главный герой – Иво – молодой и симпатичный парень, страдающий от недостатка любви отца. И на то, как оказалось, есть причины. Луиса Рапалло – жена Федерико, выходила замуж беременной, а жених об этом знал.

А после 270 серий зрители узнали, что Мили – дочь главы семейства, рожденная от служанки Росарио Бернардо, продолжающая заниматься домашней работой семейства.

Мариана Ариас сыграла в сериале роль соперницы Милагрос – Андреа, которая мастерски умела строить козни и отправлять жизнь другим людям.

Клаудия Оана (Изабелла ). Сериал «Новая жертва»

Сериал, снятый телекомпанией «Глобу», вышел в прокат в 1995 году. В России премьера состоялась годом позже – 15 июля 1996 года. Сюжет сериала отличался от обычных бразильских теленовелл. В нем присутствовала детективная линия, очень похожая на роман Агаты Кристи «Десять негритят», – такой же аллегорический список жертв в виде зверей китайского гороскопа.

«Новая жертва» затронула очень много тем, о которых в нашей стране тогда все еще говорили шепотом: наркомания, проституция, гомосексуализм. На покупку теленовеллы претендовали многие компании, но их сильно не устраивал финал. Специально для европейского зрителя авторы отдельно отсняли последнюю серию, где изменили имя убийцы.

Главную злодейку – Изабеллу – сыграла Клаудия Оана. Смесь роковой красоты и жестокости вызвал бурю эмоций у зрителя – героиню полюбили, несмотря на резко отрицательный окрас. Чего она только не делала: и изображала любящую племянницу, и откровенно пользовалась мужчинами, и отравляла жизнь главной героине Анне.

Рената Сорра (Назаре). Сериал «Хозяйка судьбы»

Премьера этого сериала состоялась в начале 2000-х. У главной героини, которую сыграла Сюзана Виейра, пятеро детей. Ей самой пришлось пробивать себе дорогу в жизни, чтобы обеспечить всем безбедное будущее. Много лет назад у нее украли новорожденную дочь, за которую она борется, будучи уже почтенной дамой.

В основу сюжета легла реальная история, взятая сценаристами из раздела «Происшествия» местной газеты. В статье рассказывалось о женщине, которая в 1986 году похитила ребенка и воспитывала его, как своего собственного, пока ее не нашла полиция. Второй ребенок «похитительницы» тоже оказался украденным – это обнаружилось спустя 17 лет!

Одной из самых запоминающихся стала роль злодейки Назары, за исполнение которой актриса Рената Сорра получила не одну престижную премию.

Клаудия Рая (Анжела). Сериал «Вавилонская башня»

Сюжет основан на библейской притче о Вавилонской башне, в которой людей наказали за гордыню и непонимание друг друга. Герои сериала вели себя ничуть не лучше: лицемерие, предательство, агрессия, месть – вот лишь небольшая часть того, во что были погружены зрители. Вышедший после двадцатилетнего тюремного заключения Жозе Клементино решает отомстить своему бывшему шефу, на показаниях которого когда-то основывалось обвинение. Он принимает решение взорвать торговый центр «Tropical Towers», принадлежащий ненавистному врагу, и приводит план в действие. Казалось бы, факты на поверхности: преступник очевиден. Но не все так однозначно – сценаристы оставляют зрителя в неведении и заставляют сомневаться до последней серии.

Клаудии было 32, когда сериал вышел на экраны. Ей досталась роль холодной и расчетливой женщины с мужским и несгибаемым характером. Поклонники не одобрили образ Анжелы, посчитав, что деловые костюмы несовместимы с актрисой. А вот кинокритики с этим не согласились, назвав роль одной из самых успешных в карьере Клаудии.

Глория Перес. Ракел «Секреты тропиканки»

Мировая премьера состоялась в феврале 1993 года. Сериал по сценарию Ивани Рибейру – ремейк черно-белой «мыльной оперы», показанной по телеканалу «ТВ Тупи» в 1973 году. Главную роль сыграла Глория Перес.

Сериал рассказывает историю двух сестер, абсолютно одинаковых снаружи и диаметрально противоположных внутри. Ракел мечтает о беззаботной и обеспеченной жизни, Рут – любить и быть любимой. Бразильский сериал не был бы бразильским без любовной линии.

Не нужно быть Нострадамусом, чтобы догадаться: объект вожделения у сестер был один на двоих. Конечно же, все перипетии закончатся хорошо – любовь спасет мир!

Самым популярным и запоминающимся персонажем в фильме стали вовсе не близняшки, а Тонью по прозвищу «лунатик», блестяще сыгранный Маркусом Фротой. Только не говорите, что не помните этого персонажа. Ради роли Маркусу пришлось поправиться на 7 кг. На что не пойдешь ради зрителя (на какие еще жертвы шли актеры ради роли мы писали здесь).

Патриссия Пиллар (Флора). Сериал «Фаворитка»

Сериал «Фаворитка» вышел в прокат в 2008 году – одно из последних творений кинокомпании Globo. Теленовелла рассказывает о двух подругах, которые с детства были не разлей вода и даже выступали дуэтом на сцене, а потом стали злейшими врагами, влюбившись в одного и того же парня – Марсело. Последнего бросало из стороны в сторону – обе девушки родили от него детей. А потом Марсело убили при загадочных обстоятельствах.

Обвинение было предъявлено Флоре, с которой он на тот момент жил. Девушку осудили за убийство и посадили в тюрьму на 18 лет. Когда она вышла на свободу, началось самое интересное. Флора придумала план мести и привела его в действие.

Сериал шел на бразильском телевидении почти год и стабильно собирал у экранов от 50% до 60% населения – так выглядит успех.

Клонирование и характеристика GLOSSY1, гена кукурузы, участвующего в кутикулярной мембране и производстве воска. взаимодействия растений и насекомых. Здесь мы описываем молекулярное клонирование и характеристику гена кукурузы (

Zea mays ) GLOSSY1 ( GL1 ), компонента пути, ведущего к биосинтезу кутикулярного воска в листьях проростков.Геномные последовательности и последовательности кДНК, которые мы выделили, значительно отличаются по длине и большей части кодирующей области от ранее идентифицированных. Предсказанный белок GL1 включает три домена, богатых гистидином, ориентир семейства мембраносвязанных десатураз/гидроксилаз, включая ферменты, модифицирующие жирные кислоты. Экспрессия GL1 не ограничивается ювенильной стадией развития растения кукурузы, что указывает на более широкую функцию продукта гена, чем предполагалось на основе мутантного фенотипа.В самом деле, помимо воздействия на биосинтез кутикулярного воска, мутации gl1 оказывают плейотропный эффект на развитие эпидермиса, изменяя размер трихом и нарушая структуру кутина. Было обнаружено, что из многих генов биосинтеза воска, идентифицированных к настоящему времени, только несколько из Arabidopsis ( Arabidopsis thaliana ) необходимы для нормального образования кутина. Среди них WAX2 , который на 62% идентичен GL1 на уровне белка. У восковых2 -дефектных растений изменения кутина вызывают слияние постгенитальных органов.Этот признак не проявляется у мутантов gl1 , что указывает на различную роль кутикулы кукурузы и арабидопсиса в развитии растений.

Кутикула образует внешний слой надземной части большинства растений. Физические и химические свойства этой структуры поддерживают жизненно важные функции, такие как предотвращение неустьичной потери воды, защита от УФ-излучения и уменьшение осаждения пыли, пыльцы и загрязнителей воздуха. Кроме того, он играет критическую роль в защите растений от бактериальных и грибковых патогенов и участвует во множестве взаимодействий между растениями и насекомыми (Post-Beittenmiller, 1996).

Кутикула синтезируется эпидермальными клетками и состоит из наружного слоя эпикутикулярных восков, покрывающих кутикулярную мембрану, которая состоит из сети переэтерифицированных гидрокси- и эпокси-гидроксижирных кислот, состоящих в основном из 16 и 18 атомов в длину (кутин) с вкраплениями внутрикутикулярных восков (Walton, 1990). Кутикулярные воски состоят в основном из сложных смесей алифатических молекул длиной от 16 до 34 атомов углерода, которые встречаются в виде свободных жирных кислот, альдегидов, первичных спиртов, алканов и сложных эфиров.Их производство представляет собой биологически сложный процесс, включающий множество синтетических и транспортных механизмов. Состав кутикулярных восков различается у разных видов растений, органов и тканей, а также в процессе развития. Отложение воска на поверхности листа также регулируется сигналами окружающей среды, такими как свет, влажность и температура (Kolattukudy, 1996).

Несмотря на успехи в понимании биосинтеза специфических компонентов кутина и парафина, многие вопросы, касающиеся организации и регуляции соответствующих биохимических путей, остаются без ответа.Доступность мутантов, дефицитных по накоплению кутикулярного воска у различных видов, и изоляция соответствующих генов дают полезную информацию для объяснения биосинтеза кутикулярного воска и для характеристики молекулярных аспектов регуляторного контроля (Kunst and Samuels, 2003).

У кукурузы ( Zea mays ) по крайней мере 18 локусов (локусы GLOSSY или GL ) влияют на количество и/или состав кутикулярного воска на поверхности листьев проростков (Neuffer et al. др., 1997). На основе генетического и биохимического анализа растений кукурузы, несущих различные мутации gl , была создана предварительная модель, предсказывающая два различных пути биосинтеза кутикулярного воска (Bianchi et al. , 1985). Один путь будет отвечать за синтез воска в первых пяти или шести ювенильных листьях, тогда как другой будет производить воски в течение всего жизненного цикла растения кукурузы. Продукты этих двух путей можно различить по их химическому составу: примерно 80% ювенильных восков представляют собой длинноцепочечные спирты и альдегиды, тогда как примерно 70% восков, образующихся на протяжении всей жизни растения кукурузы, состоят из сложных эфиров. Бьянки и др., 1985). Эти онтогенетические различия в составе воска приводят к различным фенотипам листьев кукурузы; ювенильные листья растений кукурузы дикого типа имеют сизую поверхность, тогда как все листья, появляющиеся позже в развитии растений, имеют глянцевую поверхность. Мутации, нарушающие ювенильный восковой путь, также придают ювенильным листьям глянцевый вид. Из-за их фенотипического внешнего вида такие мутанты были обозначены как глянцевый . Различный состав воскового слоя эпидермальных клеток ювенильных и взрослых листьев является одним из признаков, определяющих фазовый переход от ювенильного к взрослому у растений кукурузы дикого типа (Lawson and Poethig, 1995, и ссылкитам).

За последние годы были клонированы различные гены GLOSSY кукурузы, участвующие в образовании кутикулярного воска (Moose and Sisco, 1994; Tacke et al., 1995; Hansen et al., 1997; Xu et al., 1997). На основании данных, представленных Xu et al. (2002), GL8 кодирует как β -кетоацилредуктазу комплекса элонгазы жирных кислот, участвующего в производстве воска. GL2 , по-видимому, участвует в удлинении ацильной цепи от C30 до C32. Однако сравнение предсказанной последовательности GL2 с последовательностями в базах данных белков не выявило сходства с какими-либо известными синтазами жирных ацилов, чего можно было бы ожидать для компонента пути удлинения ацила (Tacke et al., 1995). Локус GL15 представляет собой ген развития, принадлежащий к семейству APETALA2 регуляторных генов, участвующих в переходе от ювенильных листьев к взрослым (Moose and Sisco, 1996). Глянцевый фенотип мутантов gl15 является вторичным по отношению к первичному мутантному дефекту, поддерживающему преждевременное развитие взрослых листьев.

Мутация в локусе GL1 вызывает резкие изменения в количестве, составе и характере кристаллизации ювенильных кутикулярных восков (Bianchi et al., 1985). Наиболее заметное свойство восков gl1 , помимо значительного восстановления альдегидов и спиртов, касается преобладающей длины цепи длинноцепочечных альдегидов и соответствующих свободных и этерифицированных спиртов, которые оказываются восстановленными на два атома углерода. В этом контексте была выдвинута гипотеза, что локус GL1 либо необходим для стадии удлинения в биосинтезе кутикулярного воска, либо влияет на поставку предшественников воска. Однако конкретная роль GL1 , выявленная в результате этих химических исследований, не была ни точной, ни окончательной.

Чтобы охарактеризовать ген Gl1 , мы провели эксперименты по мечению транспозонов с элементом Enhancer / Suppressor мутации ( En / Spm ), что привело к мечению гена GL 6 100005. locus (Maddaloni et al., 1990). В этой статье мы описываем клонирование и молекулярную характеристику этого гена. Выделенные нами последовательности генома и кДНК отличаются большей частью кодирующей области от предполагаемого гена GL1 и транскрипта, ранее идентифицированного Hansen et al.(1997). Белок, кодируемый GL1 , демонстрирует значительную гомологию со всей последовательностью продукта гена WAX2 Arabidopsis ( Arabidopsis thaliana ), участвующего как в развитии кутина, так и в продукции кутикулярного воска (Chen et al., 2003). Сходным образом, мутант gl1 демонстрирует уменьшение отложения кутикулярного воска и изменение морфологии кутикулярной мембраны и растительных волосков (трихом).

РЕЗУЛЬТАТЫ

Выделение меченных транспозоном аллелей локуса

GL1

При скрещивании, описанном в «Материалах и методах», из примерно 90 000 проростков F 1 901 было идентифицировано девять глянцевых сеянцев с ревертантными неглянцевыми секторами. Новые аллели были обозначены от gl1-m1 до gl1-m9 . Генетический анализ новых мутабельных аллелей описан Maddaloni et al. (1990). Семь аллелей gl1-m1 , 2 , 3 , 5 , 7 , 8 и 9 обусловлены поведением, противоположным ожиданию включения элемента отличаются от активатора ( Ac ). Аллели gl1-m4 и — m6 несли неавтономный элемент.

Растения, несущие аллель gl1-m5 , тестировали на функциональное присутствие в их геноме мобильного элемента En / Spm . Растения, гетерозиготные по аллелю gl1-m5 и по стабильному рецессивному эталонному аллелю gl1-ref , скрещивали с тестерными штаммами En / Spm , описанными в разделе «Материалы и методы». Было проведено три независимых тестовых скрещивания. Растения F 1 каждого тестового скрещивания подвергали самоопылению, а полученные початки оценивали на наличие зерен F 2 , демонстрирующих реверсии аллеля a1-m1 или a1-m(r) tester. Все три группы растений F 1 давали расщепляющиеся и нерасщепляющиеся початки, при этом доля первых была близка к 75%, что свидетельствует о наличии в предшественнике gl1-m5 двух несцепленных копий активного En. / Элемент SPM . F 2 зерна обеих групп колосьев выращивали до проростков, которые оценивали по пестроте листьев, обусловленной аллелем gl1-m5 . Результаты этих экспериментов суммированы в . Приблизительно половина колосьев, отделившихся на пестроцветные зерна, также дала gl1-m5 пестролистных сеянцев, в то время как колосья без пестролистных семян не дали пестролистных сеянцев.Этот результат указывает на то, что аллель gl1-m5 , вероятно, вызван вставкой автономного активного элемента En / Spm .

Таблица I.

Генетический тест на наличие En/Spm в штамме gl1-m5

9 9 9 4
Расщепление
Ford F 2 Уши с рассеянными ядрами
F 2 Уши без разнообразных ядер
GL1-M5 GL1-REF GL1- M5 GL1-REF
1 4 3 9 0 9 3 9 5 5 4 0 4
3 5 6 0 4 0 4
Всего 14 13 13 0 11 0 11

Фенотипический анализ

гл1 Мутантов

Морфология эпикулярных восков дикого типа и gl1 растений ранее исследовали с помощью сканирующей электронной микроскопии (СЭМ) Лоренцони и Саламини (1975). Это исследование показало, что клетки эпидермиса листьев проростков gl1 практически лишены воска, за исключением вспомогательных клеток устьиц и клеток каймы листа. Экструзия воска на листьях gl1 уменьшена в размерах и имеет округлую форму в отличие от кристаллической микроструктуры эпикутикулярного воска дикого типа.

Восковые фенотипы GL1 аллеля дикого типа, рецессивного gl1-ref аллеля и нестабильного gl1-m5 аллеля показаны на , как показано визуально и под микроскопом.Аллель gl1-m5 демонстрирует явную соматическую нестабильность, которая видна как участки ткани дикого типа на мутантном фоне (4). Ревертантные участки могут покрывать небольшие или большие части листа (до половины) или ограничены отдельными эпидермальными клетками. Это открытие показывает, что GL1 , как и другие гены GL , действует на клетку автономно во время развития молодых листьев (Moose and Sisco, 1994; Tacke et al., 1995).

Листовая поверхность у аллелей дикого типа и gl1 .Фенотип аллеля дикого типа в локусе GL1 (A) по сравнению со стабильным рецессивным (B) и мутабельным (C) аллелем, как видно под водой. D, фенотип, наблюдаемый на абаксиальной поверхности второго листа при СЭМ: ревертированные клетки кажутся белыми на темном фоне. SEM-анализ листовых поверхностей дикого типа (E) и мутантов (F). Врезки: крупный план верхней поверхности, показывающий детали морфологии и плотности трихом (все изображения увеличены в 100 раз). Показан ПЭМ-анализ кутикулярных мембран дикого типа (G) и мутантных (H).CU, кутикула; КС, клеточная стенка.

Клетки эпидермиса листьев кукурузы расположены в виде клеточных рядов, простирающихся в продольном направлении параллельно жилкам и демонстрирующих градиент дифференцировки клеток от основания листа к кончику листа. Отдельные клеточные ряды обогащены устьицами, другие – трихомами, а третьи лишены обоих типов специализированных эпидермальных клеток. Мутантные трихомы gl1 меньше и расположены ближе друг к другу по сравнению с диким типом. В апикальной области полностью развитых ювенильных листьев их размер примерно вдвое меньше, чем у дикого типа; на краю листа среднее расстояние между трихомами мутанта и дикого типа составляет 124 ± 14 мкм м и 171 ± 28 мкм м соответственно ().Распределение устьиц на gl1 листьев не отличается от дикого типа.

Ультраструктурный анализ кутикулы листа с помощью просвечивающей электронной микроскопии (ПЭМ) показывает, что мембрана кутикулы дикого типа, по-видимому, разделена на самый внешний полупрозрачный слой (собственно кутикула) и самый внутренний непрозрачный слой (сетчатый кутикулярный слой; ). У мутанта gl1 толщина мембраны кутикулы явно уменьшена примерно на 50%, а собственно кутикула почти отсутствует (1).Никаких различий в проницаемости для хлорофилла не было обнаружено в gl1 листьев по сравнению с листьями дикого типа, как определено с экстракцией в 80% этаноле, с предварительным удалением кутикулярного воска или без него (данные не представлены). У растений gl1 не наблюдается снижения фертильности пыльцы, вероятно, потому, что мутация затрагивает воски, обнаруживаемые на ювенильных листьях.

Выделение и характеристика аллеля

gl1-m5

Внутренний фрагмент Eco RI/ Bam HI элемента En / Spm использовали в качестве гибридизационной пробы в ДНК. семьи, разделенные на gl1-m5 .Был идентифицирован фрагмент Hin dIII размером 8,3 т.п.н., который косегрегировал с мутантным фенотипом gl1-m5 . Репрезентативные гомозиготные (дорожки 4 и 5) и гетерозиготные (дорожки 6 и 7) растения gl1-m5 с гибридизирующим фрагментом En / Spm длиной 8,3 т.п.о. показаны на рис. Доказательство того, что фрагмент Hin dIII представляет собой вставку En / Spm в гене GL1 , получено из-за отсутствия этого фрагмента у растений, гомозиготных по зародышевым реверсированным аллелям, происходящим от gl1-m5 (, дорожки 2 и 3). Никакие другие En / Spm гибридизирующие фрагменты из растений gl1 m5 не обнаруживались постоянно отсутствующими в этих производных.

Саузерн-анализ локуса gl1-m5 и других мутабельных аллелей. ДНК кукурузы, расщепленную Hin dIII, подвергали Саузерн-гибридизации. Фрагмент Eco RI/ Bam I, охватывающий область между позициями 2,518 и 4,459 элемента En / Spm и 0.Фрагменты, производные 95 т.п.н. Hin dIII -Xho I gl1-m5 , использовали в качестве зонда в А и В соответственно. Аллели сконструированы следующим образом: (1) аллель дикого типа из инбредной линии WF9; (2) GL1-Rev2 и (3) GL1 Rev3 ; ревертантные аллели, полученные от gl1-m5 ; 4 и 5 – гомозиготные растения gl1-m5 ; (6 и 7) растения, гетерозиготные по gl1-m5 и gl1 ref , демонстрирующие мутабельный фенотип gl1 ; и (8) гомозиготные растения gl1-ref . А. Характерная для аллеля gl1-m5 полоса размером 8,3 т.п.н. отсутствует у ревертантных производных gl1-m5 . B, блот в A был снят и повторно гибридизован с зондом Hin dIII -Xho I, полученным из gl1-m5 . Указаны фрагмент 8,3 т.п.н. Hin dIII из аллеля gl1-m5 и фрагмент 6,0 т.п.н. из GL1 -Wf9 и ревертанта gl1-m5 или gl1-ref аллелей. C, эксперименты по перекрестным ссылкам на аллели.ДНК, выделенная из растений, несущих семь нестабильных мутантных аллелей gl1-m1 (1), -m2 (2), -m3 (3), -m5 (4), — m7 (5). ), — m8 (6) и — m9 (7) расщепляли Hin dIII, подвергали электрофорезу на агарозном геле и переносили на нейлоновую мембрану. Гибридизация с фрагментом λ -09 Hin dIII -Xho I длиной 0,95 т.п.н. выявила полиморфизм, связанный с аллелем gl1-m5 по отношению к другим мутабельным аллелям gl1 En / Spm . Указаны размеры молекул (т.п.н.).

Фракционированную по размеру субгеномную библиотеку фрагментов Hin dIII из гетерозиготных растений gl1-m5 сконструировали в векторе λ EMBL3, а фрагмент Hin dIII размером 8,3 т.п.о. -09 с использованием датчика Eco RI/ Bam HI элемента En / Spm . Рестрикционная карта клонированного фрагмента Hin dIII указывала на присутствие элемента En / Spm , фланкированного последовательностями, отличными от En / Spm .Фрагмент рестрикции (0,95 т.п.н. Hin dIII -Xho I), несущий последовательность не- En / Spm , использовали в качестве зонда для гибридизации с тем же ДНК-блоттингом, показанным на рис. Результирующий образец гибридизации показан на рис. Гомозиготные растения gl1-m5 , проявляющие нестабильный фенотип в присутствии автономного En / Spm , показали ожидаемый фрагмент Hin dIII размером 8,3 т. п.н. и низкоинтенсивный фрагмент 6,0 т.п.н. (дорожки 4). и 5).Фрагмент размером 6,0 т.п.н. коррелировал с образованием соматических ревертантных секторов от gl1-m5 и, таким образом, представлял исходный аллель-предшественник. Доказательство того, что фрагмент Hin dIII -Xho I размером 0,95 т.п.н. представляет собой часть гена GL1 , было получено путем сравнения двух независимых зародышевых ревертантных производных gl1-m5 (дорожки 2 и 3) с их мутабельными братьями и сестрами (дорожки 2 и 3). дорожки 4–7). Гомозиготные ревертантные растения содержали только гибридизирующий фрагмент Hin dIII длиной 6,0 т.п.н., тогда как их мутабильные сибсы, гетерозиготные по аллелям gl1-m5 и gl1-ref , содержали аллели 8.Фрагменты размером 3 и 6,0 т.п.н. (дорожки 6 и 7). Разница в размерах между рестрикционным фрагментом, представляющим gl1-m5 , и его соматическими и зародышевыми ревертантными производными соответствовала вставке En / Spm , наблюдаемой в клонированном фрагменте 8,3 т. п.н. Hin dIII ().

Хотя эти результаты показали, что λ -09 содержит фрагмент ДНК, косегрегирующий с аллелем gl1-m5 , они не позволили однозначно установить, что этот клон произошел от локуса GL1 .Чтобы установить, действительно ли фрагмент ДНК в клоне λ -09 представляет локус GL1 , фрагмент 0,95 т.п.н. . Обоснованием этих экспериментов было то, что если этот зонд происходит из локуса GL1 , то он должен обнаруживать RFLP между нестабильными мутантами gl1 и их соответствующими аллелями дикого типа. Саузерн-блоттинг проводили на ДНК семи независимых мутабельных аллелей gl1 (каждый из которых нес независимо полученный аллель gl1 En / Spm ).Гибридизация с фрагментом Hin dIII- Xho I размером 0,95 т.п.н. из λ -09 выявила фрагмент разного размера в соответствии со специфическим аллельным состоянием локуса GL1 (). Все данные, полученные в ходе Саузерн-экспериментов, убедительно свидетельствовали о том, что зонд, использованный для гибридизации, был способен распознавать аллельные состояния, модифицирующие на молекулярном уровне локус GL1 . Был сделан вывод, что последовательности ДНК Hin dIII- Xho I размером 0,95 т.п.н., выделенные из клона λ -09, маркируют специфический участок генома кукурузы, соответствующий локусу GL1 .

Анализ последовательности локуса

GL1

Фрагмент Hin dIII- Xho I, полученный из клона λ -09, использовали в качестве молекулярного зонда в экспериментах по гибридизации библиотеки искусственных хромосом бактерий кукурузы (ВАС). получен от инбредной линии F 2 . Было идентифицировано двадцать три независимых клона, восемь из которых впоследствии были проанализированы с помощью рестрикционного картирования. Два соседних фрагмента Hin dIII, один из которых гибридизировался с молекулярным зондом, полученным из клона λ -09, удалось идентифицировать во всех рассмотренных клонах и использовать для получения нуклеотидной последовательности всего локуса GL1 вместе с 2.Фрагмент промотора размером 1 т. п.н.

Компьютерный анализ полученной геномной последовательности идентифицировал предполагаемые экзоны, охватывающие транскрипт GL1 . Поиск в базе данных белков, гомологичных выведенному полипептиду GL1, подкрепил предполагаемую последовательность мРНК. На основании этих данных были разработаны два праймера для выделения полноразмерной кодирующей последовательности GL1 с помощью ПЦР с обратной транскрипцией (ОТ). Одиночный фрагмент длиной 2056 п.н., включая открытую рамку считывания (ORF) длиной 1866 нуклеотидов, амплифицировали из РНК, выделенной из листьев проростков дикого типа инбредного Wf9.Из частичного клона кДНК, выделенного из библиотеки кДНК проростков, мы сделали вывод, что транскрипт GL1 содержит нетранслируемую область (UTR) длиной 240 п.н. на своем 3′-конце (данные не показаны). Ранее было обнаружено, что длина 5′-UTR составляет 185 п.н. В совокупности эти данные предполагают приблизительную длину транскрипта GL1 в 2291 п. н. Внутрирамочный стоп-кодон присутствовал на 87 п.н. выше стартового кодона ATG основной ORF. Альтернативные сайты начала трансляции отсутствовали, что указывало на то, что амплифицированный фрагмент включал полную кодирующую область.Предполагаемые CAAT- и ТАТА-бокс-мотивы были обнаружены в промоторной последовательности на 200 и 146 п.н. выше старт-кодона ATG, соответственно, тогда как предполагаемый сайт полиаденилирования присутствовал на 312 п.н. ниже стоп-кодона трансляции.

Выравнивание кДНК и геномных последовательностей выявило наличие восьми несмежных участков гомологии, перемежающихся семью интронными последовательностями размером от 95 до 2025 п.н. (). Выведенная кодирующая последовательность отображает три различия в одиночных основаниях по отношению к рассматриваемой геномной последовательности.Это несоответствие обусловлено полиморфизмом между двумя штаммами, используемыми для выделения геномных клонов и клонов кДНК, что подтверждается анализом последовательности соответствующих геномных областей инбредной линии Wf9 (данные не показаны).

Молекулярная карта локуса GL1 . Представлены последовательности экзонов (верхняя строка) вместе с чередующимися последовательностями интронов (средняя и нижняя строки). Приблизительное положение сайтов вставки последовательностей мобильных элементов En / Spm , присутствующих в мутабельных аллелях gl1 ( m1 m9 ), указано стрелками, указывающими ориентацию мобильных элементов.Старт- и стоп-кодоны TGA, а также сайты рестрикции Apa I (A), Bam HI (B), Hin dIII (H), Kpn I (K), Sal I (Sa), Spe I (Sp) и Sst I (Ss) эндонуклеазы. Сегменты ДНК, используемые в качестве молекулярных зондов в Саузерн-анализе, обозначены I, III и IV. Зонд II, состоящий из фрагмента Sst I (интрон 3)- Sst I (интрон 4), не указан.

Картирование

En / Spm Сайтов вставки

Доступные нестабильные аллели gl1 исследовали с помощью Саузерн-анализа с использованием различных фрагментов гена GL1 в качестве зондов. Было обнаружено, что все нестабильные аллели вызваны независимыми вставками членов семейства мобильных элементов En / Spm . Для всех семи нестабильных аллелей были определены примерный сайт вставки и ориентация элементов относительно гена GL1 . В четырех случаях ( gl1-m1 , 2 , 5 и 8 ) мобильный элемент был встроен дистальнее сайта рестрикции Hin dIII, присутствующего в четвертом интроне локуса GL1 90,006 который ранее использовался для разграничения конца гена GL1 (; Hansen et al., 1997).

Идентификация мобильных элементов, присутствующих в различных нестабильных аллелях gl1 , и расположение точки вставки в известной последовательности гена GL1 сделали возможной ПЦР-опосредованную амплификацию специфических фрагментов, охватывающих 5′ и 3 ‘ соединения между последовательностями gl1 и терминальными подвижными элементами. GL1 — и En / Spm -специфические праймеры использовали в реакциях амплификации ПЦР (см. дополнительные таблицы II и III), генерируя амплифицированные фрагменты ожидаемой длины.Все продукты амплификации секвенировали для определения точной точки встраивания мобильного элемента, присутствующего в каждом из нестабильных аллелей gl1 (). Семь вставок En / Spm все помещены в геномную область, охваченную последовательностью кДНК. Во всех случаях наблюдалась характерная дупликация сайта-мишени из трех нуклеотидов для En / Spm (данные не показаны).

Характеристика предсказанного белка GL1

Концептуальная трансляция ORF длиной 1866 нуклеотидов, присутствующей в последовательности кДНК GL1 , привела к предполагаемому полипептиду из 621 аминокислоты с кажущейся молекулярной массой 69.6 кДа и pI 9,89. Анализ гидропатии предсказал наличие нескольких трансмембранных доменов в N-концевой области полипептида GL1, а также гидрофильного С-концевого домена. Кроме того, в N-концевой части присутствовал трехчастный мотив, богатый His, характерный для семейства мембраносвязанных десатураз/гидроксилаз.

По сравнению с нашей кДНК последовательность, ранее идентифицированная как транскрипт GL1 Hansen et al. (1997) короче и дифференциально сплайсирован.В частности, он включает в себя первые четыре экзона нашей кДНК и два участка промежуточных последовательностей: четыре основания третьего интрона и 533 основания четвертого интрона. Первая вставка основания изменяет рамку считывания и приводит к подавлению третьего мотива, богатого His, в предполагаемом полипептиде (1).

Выравнивание гомологичных последовательностей GL1 . Последовательность белка GL1 (верхняя строка) была сопоставлена ​​с полипептидами, кодируемыми кДНК Хансена (GL1*), Arabidopsis At5g57800 (WAX2), Arabidopsis At1g02205 (CER1), рисом {«type»:»entrez-нуклеотид»,»attrs»: {«текст»:»AK060786.1″,»term_id»:»32970804″,»term_text»:»AK060786.1″}}AK060786.1 (EST-Os) и S. odorus {«type»:»entrez-нуклеотид»,»attrs «:{«text»:»L33792″,»term_id»:»498037″,»term_text»:»L33792″}}L33792 (EST-So). Идентичные остатки выделены черным цветом, а аналогичные остатки — серым. Законсервированная десатураза /гидроксилазный домен отмечен серой линией над последовательностью GL1.Более темные серые сегменты обозначают консервативные остатки His в пределах десатуразного/гидроксилазного домена.

Поиск в базе данных белков, гомологичных GL1, с помощью алгоритма TBLASTX выявил несколько последовательностей, демонстрирующих высокий уровень сходства с используемой последовательностью запросов.В частности, предполагаемый полипептид из 619 аминокислот, кодируемый кДНК риса ( Oryza sativa ; {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AK060786″,»term_id»: «32970804»,»term_text»:»AK060786″}}AK060786) показал 84% идентичность по всей своей кодирующей последовательности. Кроме того, были обнаружены значительные гомологии с показателем идентичности 67% с продуктами двух других кДНК риса ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AK066569″,»term_id» :»32976587″,»term_text»:»AK066569″}}AK066569 и {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»AK070469″,»term_id»:»32980493″,»term_text «:»AK070469»}}AK070469), с локусом WAX2 арабидопсиса, кодирующим белок, участвующий в синтезе кутикулы (идентичность 62%), и частичный полипептид ({«type»:»entrez-нуклеотид»,»attrs» :{«текст»:»L33792″,»term_id»:»498037″,»term_text»:»L33792″}}L33792) получен из Senecio odorus (идентичность 55%). Выравнивание выведенной аминокислотной последовательности GL1 и выведенных белковых последовательностей, демонстрирующих высокие показатели сходства, показано на рис. Наивысшая степень гомологии устойчиво относится к С-концевой части выведенных белков.

Сравнение полученной последовательности белка GL1 и продукта локуса Arabidopsis ECERIFERUM1 ( CER1 ), предполагаемой альдегиддекарбонилазы, активной в пути биосинтеза кутикулярного воска, показывает общую идентичность на 35%.Этот показатель сходства был значительно ниже, чем степень сходства между предполагаемыми белками GL1 и Arabidopsis WAX2 (62%). Поскольку предыдущие результаты приписывали локусу кукурузы GL1 роль ортолога Arabidopsis CER1 , мы исследовали сходство аминокислотных последовательностей среди ограниченной группы последовательностей гомологов GL1 с помощью филогенетического анализа (). Эти анализы предполагают наличие двух групп белковых последовательностей, первая из которых содержит белок CER1 в качестве исходной последовательности, а последняя включает последовательность WAX2. Интересно, что последовательность GL1 показала высокий уровень гомологии с членами группы WAX2, в то время как вторая последовательность кукурузы (GenBank {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AY104752″, «term_id»:»21207830″,»term_text»:»AY104752″}}AY104752) был расположен в группе CER1, с которой он имеет 55% идентичность аминокислот. Таким образом, филогенетический анализ показал, что последовательностей, родственных Gl1 , можно разделить на две подгруппы, каждая из которых включает гены по крайней мере трех видов: кукурузы, риса и арабидопсиса (4).

Филогенез GL1 -подобных последовательностей. Выведенная аминокислотная последовательность локуса GL1 была сопоставлена ​​с 12 выведенными последовательностями, полученными из гомологичных локусов, доступных в GenBank. Для получения филогенетического дерева был использован анализ объединения соседей, который был загружен более чем за 1000 циклов. Значения значимости выше порога отсечки 50% указаны рядом с соответствующими ответвлениями. Две отдельные группы заключены в рамки: CER1 -родственные последовательности (I), включая рис {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AK066386″,»term_id»:»32976404″, «term_text»:»AK066386″}}AK066386, кукуруза {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AY104752″,»term_id»:»21207830″,»term_text»:»AY104752 «}}AY104752, рис {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AK100751″,»term_id»:»32985960″,»term_text»:»AK100751″}}AK100751, рис {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AK068166″,»term_id»:»32978184″,»term_text»:»AK068166″}}AK068166, Arabidopsis At1g02205 ( CER1 ) , арабидопсис At2g37700 и арабидопсис At1g02190; и WAX2 -родственные последовательности (II), включая Arabidopsis At5g57800 ( WAX2 ), S.запах {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»L33792″,»term_id»:»498037″,»term_text»:»L33792″}}L33792, кукуруза {«тип» :»entrez-нуклеотид»,»attrs»:{«текст»:»AY505017″,»term_id»:»40950053″,»term_text»:»AY505017″}}AY505017 ( Gl1 , это исследование), рис {» type»:»entrez-нуклеотид»,»attrs»:{«text»:»AK060786″,»term_id»:»32970804″,»term_text»:»AK060786″}}AK060786, рис {«type»:»entrez- нуклеотид»,»attrs»:{«текст»:»AK066569″,»term_id»:»32976587″,»term_text»:»AK066569″}}AK066569 и рис {«type»:»entrez-нуклеотид»,»attrs «:{«текст»:»AK070469″,»term_id»:»32980493″,»term_text»:»AK070469″}}AK070469. Масштабная линейка, коэффициент подобия.

GL1 Анализ транскрипции

3′-конец кДНК GL1 использовали в качестве зонда в экспериментах по нозерн-блоттингу, проведенных с тотальной РНК, экстрагированной из различных тканей растений дикого типа и из ткани листа, гомозиготной по аллель gl1-ref . Как показано на , РНК, извлеченная из проростков дикого типа, показала транскрипт с расчетным размером 2300 остатков, что соответствует ожидаемой длине мРНК GL1 (дорожка 1).Накопление этой РНК резко снижено у мутанта gl1-ref (дорожка 2) и полностью блокировано в корне, где вместо этого обнаруживается транскрипт большего размера (дорожка 3). Экспрессия GL1 была очевидна также во взрослых листьях (дорожка 4) и в цветочных органах (шелковицах и пыльниках; дорожки 5 и 6 соответственно), что свидетельствует о том, что активность GL1 не ограничивалась ювенильной фазой развития растения кукурузы. Та же картина гибридизации наблюдалась с использованием полной кДНК Gl1 в качестве зонда (данные не показаны). Чтобы проверить количество загруженной РНК, фильтры удаляли и повторно исследовали с помощью клона цитозольного GAPDH кукурузы (10). Транскрипт GL1 был дополнительно изучен с помощью анализа ОТ-ПЦР с использованием образцов, описанных выше (). Использование прямого и обратного праймеров GL1 позволило амплифицировать фрагмент ожидаемого размера из образцов РНК, полученных из проростков дикого типа (дорожка 2), и при низкой численности из мутантного листа gl1-ref (дорожка 3). ), зрелый лист (дорожка 5) и ткань пыльника (дорожка 7).ПЦР-амплификацию с праймерами против цитозольной GAPDH использовали для проверки целостности образцов (1).

Нозерн-анализ и анализ ОТ-ПЦР транскрипции GL1 . A, мРНК, выделенная из молодого листа дикого типа (1), молодого листа gl1-Ref (2), корня (3), старого листа дикого типа (4), шелка (5) и ткани пыльника (6). гибридизовали с 3′-концом кДНК GL1 . B. Тот же блот в A был удален и регибридизирован с зондом GAPDH. C и D. Наличие транскриптов GL1 (C) и GAPDH (D) было проанализировано с помощью ОТ-ПЦР в молодом листе дикого типа (2), молодом листе gl1-ref (3), корне (4) , старый лист дикого типа (5), шелк (6) и ткань пыльника (7).Маркеры размера, присутствующие на дорожке 1, использовали для определения размеров продуктов амплификации, как указано справа.

Как видно из рисунка, из экстрактов корня (дорожка 3) и шелка (дорожка 5) с помощью ОТ-ПЦР не было получено амплификации РНК. В этом отношении мы идентифицировали неполный клон, родственный Gl1 , путем скрининга библиотеки кДНК шелка с использованием Gl1 в качестве зонда (H. Hartings, R. Velasco и M. Motto, неопубликованные данные). Эта шелковая кДНК демонстрирует 78% идентичность с Gl1 ; северные эксперименты, проведенные с теми же образцами, что и в, дают аналогичную картину гибридизации, но с более высокой интенсивностью в экстракте шелка (см.7). Это было воспринято как доказательство того, что ген, родственный Gl1 , экспрессируется главным образом в шелковой ткани и дает перекрестную гибридизацию мРНК с зондом Gl1 .

Что касается полосы на дорожке 3, то это может быть либо специфичный для корня транскрипт, родственный по последовательности Gl1 , либо несплайсированная версия Gl1 , не амплифицированная с помощью ОТ-ПЦР в используемых условиях. Однако при использовании различных комбинаций Gl1 -специфических праймеров, направленных на идентификацию присутствия последовательностей интронов в транскрипте Gl1 , мы не получили указаний на присутствие несплайсированной версии мРНК Gl1 в корневом экстракте (данные не показано).Соответственно, эта полоса, вероятно, является результатом неспецифической кросс-гибридизации.

ОБСУЖДЕНИЕ

Молекулярное клонирование и характеристика локуса

GL1

Для получения молекулярного понимания природы генетического повреждения, которое приводит к фенотипу gl1 , набору нестабильных мутаций gl1 из семейства En / Spm было получено (Maddaloni et al. , 1990). Из одного из этих мутабельных аллелей была идентифицирована и молекулярно клонирована частичная последовательность Gl1 , что подтверждено экспериментами по перекрестным ссылкам на аллели и нозерн-блоттингу, и использована для восстановления полного гена из геномной библиотеки кукурузы. GL1 представляет собой ген с одной копией, который дает начало транскрипту, несущему ORF длиной 1866 п.н. и охватывающему восемь несмежных участков генома. Геномная область, охватываемая последовательностью кДНК, включает все сайты вставки En , обнаруженные в нестабильных аллелях gl1 .

В совокупности наши результаты показывают, что мы клонировали геномную последовательность GL1 и полную кодирующую область ее основного транскрипта. Хансен и др. (1997), которые провели аналогичные эксперименты для характеристики гена GL1 , выделили геномный клон и клон кДНК, которые, согласно нашим результатам, представляют собой часть локуса GL1 и по-разному сплайсированную/частично непроцессированную мРНК соответственно. Наши выводы основаны на нескольких линиях доказательств. Сначала была проанализирована вся коллекция из семи независимых вставок En / Spm для определения положения мобильного элемента в нестабильных аллелях gl1 . В четырех случаях последовательность вставки En / Spm расположена ниже кодирующей области гена GL1 , как описано Hansen et al. (1997). Во-вторых, кДНК, выделенная Hansen et al. имеет длину 1585 п.н., включает только первые четыре экзона нашей кДНК и кодирует полипептид из 319 аминокислот, гомологичный CER1 и родственным белкам, ограниченным N-концевой областью.С-концевой домен не имеет аналогов ни в одном из идентифицированных до сих пор гомологов GL1 . Более того, этот полипептид включает только первые два мотива, богатых His. В-третьих, клон Хансена точно соответствует 5′-области нашей геномной последовательности. Поскольку GL1 представляет собой однокопийный ген, делается вывод, что обе последовательности происходят из одного и того же локуса. Однако первый был выделен путем скрининга геномной библиотеки, сконструированной из ДНК, расщепленной Hin dIII. Вполне вероятно, что наличие короткого транскрипта GL1 и сопутствующая молекулярная ситуация в локусе GL1 , представляющем сайт Hin dIII в четвертом, относительно длинном интроне, позволили предположить (Hansen et al., 1997), что сайт Hin dIII расположен за концом гена GL1 . В заключение, наши данные, касающиеся транскрипта GL1 , его кодирующей области и распределения сайтов вставки элементов En / Spm в локусе, позволяют предположить, что полипептид, описанный Hansen et al. недостаточно для выполнения функции гена GL1 .

Ген

GL1 кодирует WAX2 -родственный белок, отображающий трансмембранные домены виды растений.Эти полипептидные последовательности обнаруживают несколько предсказанных трансмембранных доменов в N-концевой области и глобулярный домен в С-концевой части. Общим признаком этих белков является наличие восьми консервативных His-мотивов в тройственном домене HX 2–4 -H, HX 2–3 -HH, (H/Q)-X 2–3 — HH, которые образуют сайт связывания ди-железа, необходимый для каталитической активности большого семейства интегральных мембранных ферментов, таких как ацилдесатуразы, алкилгидроксилазы, эпоксидазы, ацетиленазы, метилоксидазы, кетолазы и декарбонилазы, активность которых обнаружена у прокариот и эукариоты (Шенклин и Кахун, 1998, и ссылки.там). Родственные белки GL1 , идентифицированные посредством сравнения последовательностей, включают продукты генов WAX2 и CER1 арабидопсиса, оба из которых участвуют в производстве кутикулярного воска. Интересно, что в генах GL1 , WAX2 и CER1 положения интронов сохраняются (см. Дополнительный рисунок 8), что предполагает общее происхождение от одного и того же гена-предка. Однако GL1 демонстрирует 62% общую аминокислотную идентичность с WAX2, которая возрастает до 78%, если рассматривать С-концевую область, по сравнению с 35% гомологией с CER1. Следовательно, GL1, вероятно, является ортологом WAX2 кукурузы. Кроме того, сравнение последовательностей ясно указывает на присутствие двух различных подгрупп генов, родственных GL1 , у риса, кукурузы и арабидопсиса. Первый, включая сам GL1 , связан с геном WAX2 арабидопсиса, в то время как последний содержит последовательности, более похожие на CER1 , среди которых есть метка экспрессируемой последовательности кукурузы (EST; ID {«type»:» entrez-нуклеотид»,»attrs»:{«text»:»AY104752″,»term_id»:»21207830″,»term_text»:»AY104752″}}AY104752; см. ), который может быть истинным ортологом CER1 кукуруза.

Мутации GL1 , CER1 и WAX2 вызывают резкие изменения состава и характера кристаллизации кутикулярных восков (Lorenzoni and Salamini, 1975; Bianchi et al., 1985; Jenks et al.; Chen et al., 1995). др., 2003). Кутикулярный воск ювенильных листьев кукурузы состоит из первичных спиртов (63%), альдегидов (20%) и сложных эфиров (16%), в основном полученных из ацильных фрагментов С32, тогда как на стеблях арабидопсиса основными компонентами являются алканы (53%) и кетоны. (23%), при этом содержание первичных спиртов и альдегидов снижено до 11% и 4% соответственно.Листья арабидопсиса почти лишены кетонов, а алканы составляют 72% от общего количества восков. Из-за этих различий в составе воска сравнение биохимического эффекта мутаций гена воска у кукурузы и арабидопсиса не дает окончательных результатов при определении гомологии функций генов.

Предполагалось, что CER1 является альдегиддекарбонилазой, поскольку мутант демонстрирует увеличение количества альдегидов и уменьшение количества продуктов декарбонилирования альдегидов, а именно алканов, вторичных спиртов и кетонов (Aarts et al., 1995). В кукурузе эти последние соединения составляют только 1% от общего количества воска кутикулы; следовательно, мутации в предполагаемой альдегиддекарбонилазе вряд ли будут идентифицированы только на основании визуального скрининга.

У мутантов Wax2 общая нагрузка воска снижается примерно на 80% из-за уменьшенного накопления всех преобладающих компонентов воска, включая альдегиды, за исключением первичных спиртов C30, которые повышены на стеблях Wax2 .

Восковая нагрузка на ювенильные листья gl1 снижена на 73% по сравнению с диким типом из-за сниженного накопления как альдегидов, так и первичных спиртов, при этом количество эфиров не меняется.Мутация оказывает ярко выраженное влияние на синтез длинноцепочечных восковых соединений (С32), в то время как синтез с более короткими ацильными цепями затрагивается меньше или даже увеличивается (Bianchi et al., 1977). Общее изменение состава воска на проростках gl1 сходно с изменением, наблюдаемым на листьях мутанта wax2 . В заключение, эти биохимические данные о составе мутантных восков также подтверждают вывод о том, что GL1 более тесно связан с WAX2 , чем с CER1.

Мутация

gl1 влияет на накопление кутикулярного воска и другие кутикулярные признаки (2003) и Kurata et al. (2003) играет важную роль в биосинтезе кутикулы. Его мутация изменяет как морфологию кутина, так и продукцию воска. Кроме того, эта мутация влияет на другие кутикулярные и растительные признаки, включая развитие трихом, транспирацию листьев, фертильность пыльцы и слияние постгенитальных органов во время раннего развития органов. Подобно wax2 -дефектным растениям, мутанты gl1-ref обнаруживают уменьшение отложения кутикулярного воска и изменения в структуре кутикулярной мембраны и развитии трихом. Однако слияние постгенитальных органов не наблюдалось у мутанта gl1-ref . В качестве возможного объяснения этих несоответствий аллель gl1-ref может обусловливать дырявую мутацию, нарушающую только некоторые из функций GL1 . Однако мутант gl1 с нулевым транскриптом демонстрирует нормальное развитие и отсутствие слияния органов (данные не показаны).Вторым возможным объяснением является различный эффект двух мутаций на морфологию кутина, который может иметь функциональное значение: у мутантов Wax2 толщина мембраны кутикулы увеличена, хотя ее масса уменьшена.

В качестве альтернативы кутикулы кукурузы и арабидопсиса могут играть разные роли в развитии растений. В дополнение к Wax2 , аномальной форме листьев1 ( ale1 ) и lacerata ( lcr ) мутанты Arabidopsis изменены в морфологии кутикулярной мембраны и демонстрируют слияние постгенитальных органов (Tanaka et al. , 2001; Веллесен и др., 2001). Вместо этого мутант длинноцепочечной ацил-КоА-синтетазы2 ( lacs2 ) демонстрирует уменьшение толщины кутина (-40%) и несколько фенотипических изменений, обычно связанных с дефектной структурой кутина, но не слиянием органов, что позволяет предположить, что этот признак очень важен. вероятно, связано с более резкими нарушениями кутина (Schnurr et al., 2004). Причинно-следственная связь между дефектами кутикулярной мембраны и слиянием постгенитальных органов у арабидопсиса подтверждается открытием, что деградация кутинового слоя у трансгенных растений арабидопсиса, экспрессирующих ген кутиназы, приводит к слипанию различных органов взрослого организма (Sieber et al., 2000).

Подобная корреляция не наблюдается у кукурузы и других однодольных растений. Мутанты кукурузы с эпидермальными клетками, способными к адгезии, включают crinkly4 ( cr4 ) и прилипающих1 ( ad1 ). Мутация cr4 оказывает широкий эффект на морфологию эпидермальных клеток, не ограничиваясь кутикулярным слоем (Becraft et al. , 1996). Мутанты ad1 обнаруживают изменения в структуре клеточных стенок и отложения эпикутикулярного воска в эпидермальном слое, в то время как кутикулярная мембрана в прикрепляющихся областях кажется интактной (Sinha and Lynch, 1998).Напротив, мутант sorghum bm-22 с сильно редуцированной кутикулярной мембраной демонстрирует нормальную структуру и развитие растения (Jenks et al., 1994). Более того, проростки кукурузы, обработанные ингибитором синтеза кутина, не имеют визуальных фенотипических изменений (Lequeu et al., 2003). В совокупности эти результаты указывают на различную роль кутикулы кукурузы и арабидопсиса в развитии растений, а именно в предотвращении слияния постгенитальных органов.

Экспрессия гена

GL1 специфична для тканей и органов и регулируется в процессе развития важный компонент пути биосинтеза ювенильного воскового слоя (Bianchi et al., 1985). Молодые листья gl1 имеют восковой химический состав взрослых листьев дикого типа. Можно сделать вывод, что регуляция экспрессии GL1 является составной частью клеточного ответа на возрастные события дифференцировки. Показано, что у кукурузы переход от ювенильного к взрослому находится под генетическим контролем с серией независимых мутаций — CORN-GRASS1 ( CG1 ), TEOPOD1 ( TP1 ), TEOPOD2 (). TP2 ), HAIRY-SHEATH-FRAYED1 ( HSF1 ; Poethig, 1988, и ссылки.там же) и GL15 (Moose and Sisco, 1996) — изменение перехода от ювенильного к взрослому вегетативному росту. Взаимодействие GL15 с TP1 и TP2 указывает на то, что GL15 действует ниже этих генов и что он необходим для их действия во время развития эпидермиса (Evans et al., 1994). Ген GL15 является транскрипционным активатором семейства регуляторных генов APETALA2 (Moose and Sisco, 1996), который, как ожидается, будет напрямую взаимодействовать с промоторами структурных генов, необходимых для накопления кутикулярного воска, что может быть экспериментально протестированы теперь, когда GL1 , GL2 и GL8 перечислены среди клонированных генов, способствующих отложению парафина.

На основании экспериментов с профилем экспрессии можно утверждать, что регуляция экспрессии охарактеризованных GLOSSY генов является более сложной, чем предсказывается только на основе фенотипов проростков. GL8 экспрессируется в различных органах взрослого растения, включая корни, хотя и в меньшей степени, чем в листьях проростков (Xu et al., 1997). GL1 не экспрессируется в корне, но обнаруживается в пыльниках и, в незначительной степени, также во взрослых листьях, подобно транскрипту GL2 , который, помимо характерного образования в молодых листьях, также обнаруживается в части побег кукурузы способствует развитию женского соцветия (Velasco et al., 2002). Эти результаты показывают, что белок GL1, как и продукты других генов GLOSSY , не просто участвует в формировании кутикулы зеленой части проростка кукурузы. Вместе эти находки указывают на то, что факторы, обуславливающие ювенильность ткани, могут реактивироваться после образования латеральной меристемы (Uhrig et al. , 1997). В качестве альтернативы, в тканях взрослых растений должен существовать другой механизм контроля, влияющий на гены биосинтеза воска.

МАТЕРИАЛЫ И МЕТОДЫ

Растительный материал

Происхождение и сохранение запаса транспозонов wx-m7 , аллеля gl1 -ref, использованного в этом исследовании, и восстановление gl1 -мутабельных штаммов описано ранее (Maddaloni et al., 1990). Вкратце, аллели gl1 были идентифицированы в поколении F 1 в результате скрещивания штамма, гомозиготного по нестабильному аллелю wx-m7 локуса WAXY , и по доминантному аллелю GL1 (используемому в качестве мужского родитель) и самка родительского штамма, гомозиготная по стабильному рецессивному аллелю gl1 ref . Оба штамма находились на генетическом фоне инбредной линии Wf9. Нестабильность аллеля wx-m7 обусловлена ​​мобильным элементом Ac (McClintock, 1962; Behrens et al. , 1984). В наших экспериментах по мечению было получено девять нестабильных аллелей в локусе GL1 . Семь, гл1-М1 , 2 , 3 , 5 , 7 , 8 и 9 , были связаны с вставкой автономного элемента, в то время как GL1-M4 и gl1-m6 были вызваны неавтономным элементом семейства мобильных элементов, отличных от Ac / Ds (Maddaloni et al., 1990).

В стоке wx-m7 также есть копии активных автономных элементов En / Spm (Michel et al., 1995). Для проверки наличия в gl1-m5 в стабильных мутантах элементов En / Spm были созданы скрещивания с двумя тестерными штаммами. Полученные растения F 1 подвергали самоопылению, а семена F 2 проверяли на мутабельность любого из двух тестирующих аллелей, a1-m(r) или a1-m1 , оба из-за вставки дефектный элемент En / Spm ( I / dSpm ) и демонстрирующий соматическую нестабильность только в присутствии активного элемента En / Spm . В его отсутствие аллель a1-m1 дает зерна бледной окраски, а аллель a1-m1(r) — бесцветная. В присутствии активного элемента En / Spm на бледном ( a1-m1 ) или бесцветном [ a1m(r) ] фоне образуются цветные пятна. Кресты и самоопыления проводились по стандартным процедурам.

Геномное клонирование и Саузерн-анализ

Кукуруза ( Zea mays ) ДНК выделяли из листьев цветковых растений или из проростков, как описано (Michel et al., 1995). Саузерн-гибридизацию и радиоактивное мечение зондов проводили в соответствии со стандартными процедурами (Sambrook et al., 1989). Клон плазмиды, несущий полный элемент En / Spm , выделенный из аллеля wx-844 , был предоставлен доктором Alfons Gierl (Мюнхен). В качестве молекулярного зонда использовали рестрикционный фрагмент Eco RI/ Bam HI, который покрывал внутреннюю область элемента En / Spm между положениями 2518-4459 (Pereira et al. , 1986).

Саузерн-анализ был выполнен для картирования положения элемента En в семи нестабильных аллелях gl1 . Для этого геномную ДНК гомозиготных мутантных растений расщепляли рестрикционными ферментами Bam HI, Hin dIII, Apa I, Sst I, Spe I и Kpn I. с четырьмя ПЦР-фрагментами аллеля GL1 , покрывающими районы (положения оснований указаны относительно сайта начала трансляции) от -2302 до -648 (зонд I), от +1213 до +2048 (зонд II), от + от 2426 до +3581 (зонд III) и от +4131 до +4745 (зонд IV).

Расщепленные Hin dIII геномные фрагменты размером от 7 до 11 т.п.н. из растений, несущих аллель gl1-m5 , были клонированы в вектор λ EMBL3 после разделения и очистки из агарозных гелей с помощью набора для экстракции из геля QIAEX (Qiagen , Валенсия, Калифорния). Девять клонов, гибридизирующихся с фрагментом, охватывающим последовательность En / Spm между сайтами Eco RI в положениях 5836 и 8278, были идентифицированы примерно в 100 000 рекомбинантных фагов. Рестрикционное картирование клонов идентифицировало единственный клон, обозначенный λ -09, несущий вставку Hin dIII размером приблизительно 8,3 т.п.н., который был выбран для дальнейшего анализа.

Рекомбинантные клоны, несущие аллель GL1 дикого типа, были извлечены из ВАС-библиотеки кукурузы, полученной из ДНК, выделенной из инбредной F 2 , любезно предоставленной доктором Кейтом Эдвардсом (Бристольский университет, Великобритания).

Нозерн и ОТ-ПЦР-анализ

Суммарная РНК была выделена из следующих органов и тканей инбредного Wf9: второй и третий лист проростков дикого типа и gl1-ref мутантных проростков, корни дикого типа 1-недельного — старые проростки, взрослый лист дикого типа (верхний лист, окружающий метелку), шелк дикого типа и пыльники дикого типа (как незрелые, так и осыпающиеся пыльцой, из одной и той же метелки).Экстракции проводили с использованием TRizol (Invitrogen, Carlsbad, CA) в соответствии с инструкциями производителя. Для северных экспериментов 20 мкг г образцов тотальной РНК фракционировали на денатурирующих гелях, капиллярно блоттировали на нейлоновые мембраны (Hybond N+; Amersham, Little Chalfont, Великобритания) и гибридизовали при 45°C в растворе Ultrahyb (Ambion, Austin, Техас). Фильтры промывали при 55°C в 2× SSC/0,1% SDS (15 мин), в 1× SSC/0,1% SDS (30 мин) и в 0,1× SSC/0,1% SDS (30 мин). РНК-маркеры от 0.От 2 до 10 т.п.н. (Sigma-Aldrich, Сент-Луис) использовали в качестве стандартов размера. Зонды представляли собой полноразмерную кДНК GL1 и 3′-конец из 400 п.н., включая полную 3′-UTR, частичного клона GL1 , выделенного из библиотеки кДНК проростков. Для проверки количества загруженной РНК фильтры регибридизировали с зондом, полученным из кДНК цитозольной GAPDH кукурузы.

Для ОТ-ПЦР 5 мкг мкг общей РНК подвергали обратной транскрипции с использованием обратной транскриптазы SuperScriptII (Invitrogen) в соответствии с инструкциями производителя. Одну двадцатую конечного продукта реакции амплифицировали с помощью ПЦР со следующими праймерами: прямой, 5′-ATC GAATTC ACGTACGGCACAGTTGCTAGC-3′; обратный, 5′-CGC TCTAGA CCACCAATTCACACTCGACG-3′.

Прямой праймер гибридизовали с областью кДНК GL1 , начинающейся на 70 п.н. выше стартового кодона ATG, тогда как обратный праймер гибридизовали с областью, начинающейся на 101 п.н. ниже стоп-кодона. Во избежание образования вторичных структур реакции ПЦР проводили в присутствии 10% ДМСО (конечная концентрация).5′-конец прямого и обратного праймеров включал соответственно сайты рестрикции Eco RI и Xba I (обозначены курсивом в вышеприведенных последовательностях), которые использовали для субклонирования кДНК GL1 из листьев инбредного растения. Wf9 в вектор pBluescriptSKII (Stratagene, La Jolla, CA) перед секвенированием. Пять независимых клонов секвенировали на обеих цепях для определения последовательности кДНК GL1 .

Секвенирование ДНК

Секвенирование ДНК проводили с помощью автоматического секвенатора (CEQ 8000; Beckman-Coulter, Fullerton, CA).Геномные последовательности и последовательности кДНК определяли на обеих цепях.

Микроскопический осмотр

СЭМ использовали для изучения адаксиальных поверхностей первичных листьев gl1 мутантных и диких растений, выращенных в течение 2–3 недель в фитокамере при 26°C/19°C (день/ночь) и 40 % влажности с 16/8-часовым ритмом свет/темнота и интенсивностью света 1900 мк E m -2 с -1 . Сегменты средней части листовой пластинки фиксировали на держателе образцов с помощью ткани tek и подвергали шоковой заморозке жидким азотом на стадии высоковакуумной криопрепарации.Образцы переносили под вакуумом в камеру для криоподготовки, где их напыляли золотом и исследовали на холодном предметном столике Zeiss DSM 940 SEM (Carl Zeiss NTS GmbH, Оберкохен, Германия). Для исследования кутикулы с помощью ПЭМ небольшие кусочки (2–3 мм 2 ) первичных листовых пластинок фиксировали в течение 2 ч при комнатной температуре в 2,5% (об. /об.) глутаральдегиде и 2% (об./об.) формальдегиде в 0,05 м. фосфатный буфер (ФБ), рН 6,8. После промывки в ФБ образцы постфиксировали в течение 1 ч в 2% (об./об.) четырехокиси осмия в ФБ, снова промывали и обезвоживали через последовательную серию этанола.Затем образцы пропитывали смолой LR White (Plano, Марбург, Германия) и полимеризовали в течение 48 часов при 60°C. Были изготовлены ультратонкие поперечные сечения и установлены на медные сетки Formvar с углеродным покрытием (200 меш; Plano). После окрашивания 2% уранилацетатом в течение 2 ч срезы исследовали с помощью ПЭМ Zeiss EM 10 (Carl Zeiss NTS GmbH).

Статистический анализ

Множественное выравнивание последовательностей ДНК и белков проводили с использованием ClustalW (Thompson et al., 1994), а филогенетический анализ выполняли в соответствии с версией 2 MEGA.1 программный пакет (Кумар и др., 2001). Для построения дерева на основе выровненных аминокислотных последовательностей использовался метод построения дерева с соседним соединением. Bootstrap-анализ (1000 повторов) использовался для определения консенсусного дерева с пороговым значением 50%.

Данные о последовательностях из этой статьи были депонированы в библиотеках данных EMBL/GenBank под инвентарными номерами {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AY505017″,»term_id»:»40950053 «,»term_text»:»AY505017″}}AY505017 и {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»AY505498″,»term_id»:»40794502″,»term_text»:» AY505498″}}AY505498.

Клонирование растений | Ферма Прогресс

Со временем кукуруза сможет воспроизводить себя без потери гибридной силы.

Усердные исследования и биотехнологии снова добились еще одного удивительного успеха. Исследователи из Службы сельскохозяйственных исследований Министерства сельского хозяйства США (ARS) в Вудворде, штат Оклахома, вместе с российскими учеными запатентовали гибрид кукурузы и ее дальнего родственника, гамаграсса восточного, которая может естественным образом клонировать себя. Разработка гибрида должна в конечном итоге привести к гибридным линиям кукурузы, которые воспроизводятся без потери гибридной силы, устойчивости к болезням или благоприятных агрономических свойств.

Веха. Патент ARS знаменует собой веху для генетиков растений. Чтобы растение клонировало себя, гены, контролирующие этот признак, должны были быть перенесены с гама-травы на кукурузу. Хотя это достижение далеко не полезно на коммерческом уровне, это достижение показывает, что растение, размножающееся половым путем, может быть преобразовано в бесполую разновидность.

Новое бесполое растение размножается, когда его зародыши вырастают из яйцеклеток без опыления пыльцой. Такой формой бесполого размножения является апомиксис.

Апомиксис встречается в природе у некоторых растений. Ученые идентифицировали более 300 видов, которые размножаются, клонируя себя через свои семена. Многие успешные газонные травы, такие как мятлик Кентукки, а также обычные сорняки, такие как одуванчики, воспроизводят свои семена таким образом.

Крупнейшие лаборатории растений по всему миру работали над внедрением апомиксиса в такие полевые культуры, как рис, пшеница, кукуруза и сорго.Тем не менее, исследовательская лаборатория USDA-ARS первой успешно применила эту технологию для важных зерновых культур.

Исследовательская станция Southern Plains в Оклахоме и Институт генетики в Сибири, Россия, являются совместными изобретателями патента на апомиктичную кукурузу.

«Это не чудо, которое изменит все в селекции растений», — сообщает Филипп Симс, исследователь ARS. «Это еще одно достижение, о котором семеноводческая промышленность должна подумать, когда они приступят к своей работе.Это не исключает разработки новых и улучшенных растений.

«Кроме того, нам предстоит пройти долгий путь в этой работе, включая изоляцию гена», — добавляет он.

Симс и другие исследователи сейчас пытаются определить фактический апомиктический ген или гены в образце апомиктических гибридов кукурузы и гамаграсса восточной. Как только гены будут определены, их можно будет перенести на другие линии кукурузы или зерновых культур.

«Новой апомиктической кукурузе еще далеко до сеялки фермера Среднего Запада», — говорит Симс.«Может пройти от 5 до 10 лет, прежде чем фермеры увидят эту черту в семенах, которые они покупают».

Гены травы. Ученые ARS считают, что новаторская работа российского генетика Дмитрия Петрова заложила основу для их апомиктической работы. Работа Петрова по гибридизации кукурузы и гамаграсса восточной началась в 1960-х годах. В 1993 году российский институт заключил четырехлетнее соглашение о сотрудничестве с USDA-ARS для продолжения апомиктических исследований. Российские исследования подверглись переоценке и были разработаны новые апомиктические материалы.В конце концов, в результате исследований были получены растения, очень похожие на кукурузу. Разработка этих растений привела к заявке на патент.

Работа над кукурузой и гамаграсом восточным может дать лучшее кормовое растение. Гамаграс — это многолетнее теплолюбивое растение, которым наслаждается пасущийся скот. «Работа над гамаграсом дает нам возможность создать лучшую многолетнюю траву для фермеров и владельцев ранчо в центральной части Соединенных Штатов», — говорит Симс. «Просто так получилось, что у кукурузы есть общий предок.»

Широкое использование. ARS сообщает, что несколько семенных компаний заинтересованы в его патенте. Компании смогут заключать лицензионные соглашения с ARS на использование генов гибридной кукурузы. Симс говорит, что агентство хочет сделать эту технологию широко доступной.

«Правительство не занимается кукурузой», — добавляет исследователь ARS Честер Дилд. «Наша главная цель — увидеть, как это используется на благо человечества».

Поиск культур, которые клонируют себя

Более того, поскольку культуры размножаются половым путем, потомки гибридов различаются по своим характеристикам и, как правило, не сохраняют высокую урожайность родителей. Таким образом, фермеры не могут сохранить семена урожая одного года для посадки следующего года, а должны каждый год покупать новые семена, обеспечивая семеноводческие компании постоянным доходом.

Апомиксис значительно упростит разработку гибридов, сделав их доступными для развивающихся стран, которые больше всего нуждаются в большем количестве продуктов питания, но которые в настоящее время обычно не могут себе этого позволить.

С помощью апомиктических гибридов можно сохранить семена и высадить их на следующий год без потери урожая. И фермер, получивший несколько таких семян, может воспроизвести и размножить их точно так же, как можно сделать множество совершенных копий программы.

«Это способ для местных фермеров получить контроль над своими семенами», — сказал д-р Майкл Фрилинг, профессор генетики Калифорнийского университета в Беркли. «Это выводит семеноводческие компании из бизнеса».

Действительно, апомиксис пропагандируется некоторыми в развивающихся странах как противоядие от вызывающей споры «терминаторной» технологии, экспериментального метода, позволяющего сделать растения бесплодными, чтобы фермеры приходится каждый год покупать новые семена. «Это вызов технологии терминаторов», — сказал доктор.Стивен Л. Голдман, профессор биологии Толедского университета, работает над созданием апомиктической кукурузы. «Это имеет огромное политическое значение».

На самом деле, обеспокоенные тем, что крупная семеноводческая компания может запатентовать технологию апомиксиса и лишить ее доступа к остальному миру, исследователи апомиксиса, собравшиеся в Белладжио, Италия, в 1998 году опубликовали декларацию, призывающую к «широкий и справедливый доступ к биотехнологиям растений, особенно к технологии апомиксиса».

Доктор Тони Кавальери, директор по исследованиям Pioneer Hi-Bred International, крупнейшей в стране семенной компании, преуменьшает угрозу для семеноводческих компаний.«Большинство людей, которые покупают наши семена, интересуются новейшими гибридами», — сказал он. «Они не заинтересованы в том, чтобы выращивать одни и те же гибриды в течение 20 лет». Действительно, он и другие сказали, что апомиксис может помочь семеноводческим компаниям, ускорив селекцию растений.

Клонированный ген может помочь сельскохозяйственным культурам и животноводству удовлетворить будущие потребности

11 апреля 2003 г.

Клонированный ген может помочь сельскохозяйственным культурам и животноводству удовлетворить будущие потребности

WEST LAFAYETTE, Ind. – Улучшение усвояемости корма для скота, более устойчивые культуры и более высокий выход биотоплива могут быть результатом информации, полученной исследователями из Университета Пердью о гене сорго, который контролирует твердость клеточной стенки растений.

Ученые клонировали ген, а также разработали маркеры, которые позволяют идентифицировать три мутации гена, участвующего в формировании лигнина, вещества, укрепляющего клеточную стенку растений. Когда ген не функционирует или мутировал, клеточные стенки мягче.

Исследование, подробно описывающее клонирование генов и разработку маркеров, опубликовано в выпуске Molecular Genetics and Genomics за этот месяц и в настоящее время доступно на веб-сайте журнала.

«Наши исследования сосредоточены на поиске решений для повышения продуктивности растений», — сказал старший автор исследования Уилфред Вермеррис, доцент кафедры агрономии, сельскохозяйственной и биологической инженерии.«Ценность клонирования этого гена заключается в том, чтобы помочь нам лучше понять, что изменилось в этих мутантах, чтобы мы могли внести аналогичные изменения в другие культуры, такие как райграс и кукуруза».

Ген Brown midrib (Bmr), кодирует О-метилтрансферазу кофейной кислоты (COMT), фермент, продуцирующий лигнин. По словам Вермерриса, у мутантов сорго, у которых дефектный ген, снижено количество COMT. Это приводит к тому, что мутанты содержат значительно меньше лигнина в своих листьях и стеблях по сравнению с их аналогами дикого типа или нормальными.Растения с этими генетическими изменениями имеют коричневую сосудистую ткань, а не нормальную зеленую, и они более мягкие.

Вермеррис и его соавтор, техник-исследователь Шивон Бут, клонировали Bmr после сравнения химического состава клеточных стенок мутантов. Они также идентифицировали часть гена сорго Brown midrib , которая отличается у трех мутантов, bmr12, bmr18 и bmr26. Небольшие изменения в ДНК, которые делают этот ген неактивным, можно идентифицировать с помощью инструментов, называемых молекулярными маркерами.

Мутации, смягчающие растения, улучшают усвояемость пищи, и, похоже, домашний скот также больше любит ее вкус.

«Я видел несколько опытов с овцами, проведенных профессором агрономии Purdue Китом Джонсоном, когда они позволяли овцам выбирать себе корм», — сказал Вермеррис. «Сначала они съедают всех мутантов. Когда они закончат, они съедят нормальные растения».

Поскольку в кукурузе существуют похожие мутанты, исследователи могут использовать то, что они узнали о выработке лигнина в сорго, для сравнения двух видов, лучшего понимания формирования клеточных стенок растений и создания новых разновидностей этих и других видов.

Например, сорго лучше справляется с экологическими стрессами, такими как жара или засуха, чем кукуруза, сказал Вермеррис.

«Мы заинтересованы в том, чтобы выяснить, чем кукуруза и сорго различаются по биосинтезу клеточных стенок», — сказал он. «Если мы сможем это понять, то сможем сделать кукурузу более устойчивой к стрессу».

Молекулярные маркеры, которые позволяют различать растения дикого типа и мутантные растения, ценны для будущих генетических исследований мутантов, а также для помощи селекционерам в выборе растений, сказал Вермеррис.

По его словам, выращивание более устойчивых к стрессу растений повысит урожайность. Развитие более продуктивных растений, которые могут расти в сложных условиях окружающей среды, является обязательным, поскольку население мира быстро увеличивается, а количество доступных сельскохозяйственных угодий сокращается. По данным Справочного бюро по вопросам народонаселения, ожидается, что к 2050 году численность населения вырастет с нынешних 6,3 млрд до примерно 8,9 млрд человек.

В то же время существуют некоторые свидетельства того, что средняя температура повышается, а характер осадков меняется, сказал Вермеррис. По его словам, это способствует тому, что растения подвергаются новым болезням и насекомым, а воды и земли для сельскохозяйственных нужд становится все меньше.

«Я предполагаю использовать естественные механизмы растений для разработки нового поколения сельскохозяйственных культур, которые, надеюсь, будут соответствовать требованиям будущего», — сказал он.

Эти растения будут лучше приспособлены к более суровым условиям, таким как засуха и жара, сказал он. Они также будут более усвояемыми, поэтому на фунт корма для скота можно будет произвести больше мяса и молока.

«В настоящее время на каждый фунт мяса, которое вы производите, вы должны кормить животное пятью фунтами растительных продуктов», — сказал Вермеррис. «По сути, вы тратите четыре фунта растительных продуктов в процессе преобразования».

Одним из недостатков снижения содержания лигнина в клеточных стенках растений, чтобы они были более вкусными и удобоваримыми для домашнего скота, является то, что они также могут быть вкуснее для насекомых, что приводит к большему повреждению урожая, сказал Вермеррис.

Он заметил, что одна из линий мутантов является магнитом для японских жуков.

«Меня это не очень удивило, потому что феромон, который привлекает японских жуков в коммерческие ловушки, очень тесно связан с некоторыми химическими веществами в лигнине», — сказал Вермеррис. «Нам придется проверить это, но, возможно, это объяснение того, почему насекомые могут любить эти растения больше — они могут чувствовать их запах. Кроме того, насекомым может быть легче жевать их».

Вермеррис и Бут также изучают, как изменения количества лигнина в клеточной стенке могут улучшить производство биотоплива.По словам Вермерриса, уменьшенное количество лигнина, что приводит к более мягким клеточным стенкам, должно облегчить разрушение растений для образования топлива. Это может означать производство большего количества топлива с каждого акра урожая.

Фонд Шоуолтера предоставил финансирование для этого исследования

Автор: Сьюзан А. Стивс, (765) 496-7481, [email protected] edu

Источник: Уилфред Вермеррис, (765) 496-2645, [email protected]

Ag Communications: (765) 494-2722; Бет Форбс, [email protected]; https://www.agriculture.purdue.edu/AgComm/public/agnews/

Связанные веб-сайты:
Molecular Genetics and Genomics online
Vermerris & Bout paper

 

ПОДПИСЬ НА ФОТО:
Доцент Университета Пердью Уилфред Вермеррис и его исследовательская группа клонировали ген сорго, контролирующий твердость клеточной стенки растений. Исследование сорго может способствовать повышению выносливости и усвояемости растения. Вермеррис — доцент кафедры агрономии, сельскохозяйственной и биологической инженерии.(Фото Purdue Agriculture Communication/Том Кэмпбелл)

Фотография качества публикации доступна на ftp://ftp.purdue.edu/pub/uns/vermerris.sorghum.jpeg.


Подход с использованием гена-кандидата для клонирования
гена средней жилки
сорго Brown, кодирующего кофейную кислоту O -метилтрансферазу

С. Бут 1 и В. Вермеррис 1,2 – (1) Агрономический факультет Университета Пердью, 915 W. State Street, West Lafayette, IN 47907-2054, США (2) Департамент сельскохозяйственной и биологической инженерии, Пердью Университет, Западный Лафайет, IN 47907, США

Мутанты сорго brown midrib (Bmr) имеют коричневую сосудистую ткань в листьях и стебле в результате изменений в составе лигнина.Мутанты Bmr были созданы путем химического мутагенеза с диэтилсульфатом (DES) и напоминают мутанты с коричневой средней жилкой (bm) кукурузы. Мутанты кукурузы и сорго с коричневой средней жилкой представляют особую ценность для сравнения биосинтеза лигнина у разных, но эволюционно связанных видов. Хотя мутанты sorghum brown midrib впервые были описаны в 1978 г., ни один из генов Brown midrib не был клонирован. Мы использовали подход гена-кандидата для клонирования первого гена средней жилки Brown из сорго.На основании химического анализа аллельных мутантов bmr12, bmr18 и bmr26 мы предположили, что у этих мутантов снижена активность фермента биосинтеза лигнина O-метилтрансферазы кофейной кислоты (COMT). После того как нозерн-анализ выявил сильно сниженную экспрессию гена СОМТ, этот ген клонировали из мутантов и соответствующих диких типов с помощью ПЦР. Во всех трех мутантах были идентифицированы точечные мутации, приводящие к преждевременным стоп-кодонам: bmr12, bmr18 и bmr26, следовательно, являются мутантными аллелями гена, кодирующего COMT.ОТ-ПЦР показала, что все три мутанта экспрессируют мутантный аллель, но на гораздо более низких уровнях по сравнению с контролями дикого типа. Молекулярные маркеры были разработаны для каждого из трех мутантных аллелей, чтобы облегчить использование этих мутантных аллелей в генетических исследованиях и программах разведения.

Ключевые слова: Bmr (коричневая средняя жилка), кофейная кислота, О-метилтрансфераза, клеточная стенка, лигнин, Sorghum bicolor


На страницу новостей и фотографий Purdue

Frontiers | Кукуруза (Zea mays L.) Скелетно-ядерные белки регулируют ремоделирование ядерной оболочки и функцию в развитии устьичного комплекса и жизнеспособности пыльцы

Введение

В растительных клетках, как и у всех эукариот, ядро ​​представляет собой заметную и характерную органеллу, содержащую ДНК (обзор Meier et al. , 2017). Само ядро ​​представляет собой динамическую структуру, организованную в значительной степени окружающей его мембранной системой — ядерной оболочкой (ЯО). NE представляет собой двухмембранную структуру, состоящую из внешней ядерной мембраны (ONM) и внутренней ядерной мембраны (INM), соединенных ядерными порами (обзор Hetzer, 2010; Graumann and Evans, 2017).Функциональные свойства NE опосредуются белковыми комплексами, связанными с множеством клеточных и ядерных процессов, включая деление клеток и экспрессию генов (Kim et al., 2015; Meier et al., 2017; De Magistris and Antonin, 2018; Pradillo et al. ., 2019). Основным консервативным комплексом NE является линкер комплекса нуклеоскелета и цитоскелета (LINC) (Crisp et al., 2006), известный своим участием в таких процессах, как поддержание ядерной архитектуры и механических структур, передача сигналов, подвижность ядер и позиционирование ядер. (рассмотрено Rothballer and Kutay, 2013; Chang et al., 2015; Тамура и др., 2015; Прадильо и др. , 2019; Старр, 2019). Помимо исторически признанной роли компартментализации, исследования НЭ все чаще обращаются к тому, как НЭ способствует как общим, так и специализированным функциям в росте и развитии растений. Лежащие в основе молекулярные механизмы, координирующие и регулирующие эти фундаментальные процессы НЭ, остаются, однако, в значительной степени неизвестными.

Отличительной чертой комплексов LINC является их способность образовывать прямые соединения, соединяющие цитоплазму и нуклеоплазму.Это достигается за счет сердцевинного комплекса из двух групп белков, находящихся на двух отдельных мембранах NE. INM содержит белки домена гомологии Sad1/UNC84 (SUN), а ONM содержит белки гомологии Klarsicht/ANC-1/Syne (KASH) (Hagan and Yanagida, 1995; Malone et al., 1999; Starr, 2002; Murphy et al. др., 2010). Как группа, белки KASH многочисленны и разнообразны, отражая их различных цитоплазматических партнеров по связыванию, таких как цитоскелетные и моторные белки (Starr and Fridolfsson, 2010; Luxton and Starr, 2014; Kim et al. , 2015; Эванс и Грауманн, 2018 г.; Старр, 2019). Напротив, белки SUN-домена менее разнообразны, но все же обнаруживают взаимодействия с множественными компонентами нуклеоплазмы, такими как компоненты нуклеоскелета и белки хроматина (Haque et al., 2006; Janin et al., 2017). В то время как компоненты цитоскелета комплексов LINC и белки SUN, по-видимому, консервативны у эукариот, растения развили уникальные белки KASH и компоненты нуклеоскелета. Ядерно-скелетные компоненты растений, хотя и не имеют гомологии последовательностей, обладают многими общими чертами ламинов животных, включая взаимодействие с NE и их способность влиять на структуру хроматина и экспрессию генов (Masuda et al., 1997; Диттмер и др., 2007 г.; Ван и др., 2013 г.; Циска и Морено Диас де ла Эспина, 2014 г.; Гото и др., 2014; Чжао и др., 2016; Го и др., 2017; Чой и др., 2019 г.; Циска и др., 2019; Ху и др., 2019; Сакамото, 2020).

Скелетно-ядерные белки растений, которые прямо или косвенно взаимодействуют с NE, делятся на два семейства белков. Одно семейство, белки, входящие в состав ядерного матрикса/переполненные ядра (NMCP/CRWN), обнаруживается у растений, члены которого кодируются генами NMCP у моркови (Masuda et al., 1997), гены CRWN у арабидопсиса (Dittmer et al., 2007) и гены NCH у кукурузы (Gumber et al., 2019a). Другое семейство также встречается у растений и кодируется геном AtKAKU4 у арабидопсиса (Goto et al., 2014) и генами MKAKU41 и MKAKU42 у кукурузы (Gumber et al., 2019a). Здесь мы обозначаем эти два семейства генов или белков, как правило, CRWN и KAKU4.

У арабидопсиса CRWN1 расположен преимущественно на периферии ядра и взаимодействует с белками SUN-домена (Dittmer et al., 2007; Graumann, 2014).Белки CRWN участвуют в регуляции формы ядра, размера ядра, организации хроматина, регуляции экспрессии генов и формировании ядерного тела у растений (rev. Sakamoto, 2020). Было показано, что KAKU4 взаимодействует с CRWN1 с помощью двухгибридного анализа дрожжей, подтверждая их взаимодействие в форме и функции системы нуклеоскелета растений (Goto et al. , 2014). Слияния флуоресцентных белков, управляемые экспрессией нативного промотора, и электронная микроскопия показали, что KAKU4 локализуется на внутренней ядерной мембране.Интересно, что когда были выбраны стабильные линии с высокой экспрессией или проведена временная трансформация с высокой экспрессией, KAKU4, по-видимому, индуцировал инвагинации ядер, которые значительно увеличивались при совместной экспрессии с CRWN1 (Goto et al., 2014).

Известно, что вместе белки CRWN и KAKU влияют на фенотипы эвдикотов, однако их роль в сельскохозяйственных культурах менее изучена. Известны два гомолога CRWN кукурузы; NCh2, который наиболее тесно связан с AtCRWN1-3, и NCh3, который наиболее тесно связан с AtCRWN4.Гомологи MKAKU41 кукурузы кодируются MKAKU41 и MKAKU42 (Gumber et al., 2019a). Чтобы исследовать функциональную консервацию этих предполагаемых ядерно-скелетных белков в кукурузе, мы охарактеризовали NCh2 и NCh3 и MKAKU4 , используя цитологические или генетические подходы.

Результаты

Кукуруза NCh2, NCh3 и MKAKU41 Локализованы в ядре, преимущественно на периферии ядра

Чтобы определить клеточную локализацию гомологов CRWN кукурузы NCh2, NCh3 и гомолога KAKU4 MKAKU41, мы создали генные конструкции с кодирующей белок областью, слитой либо с GFP, либо с mCherry на N-конце.Затем мы временно экспрессировали эти конструкции в ткани листа N. benthamiana . Все три конструкции, локализованные на периферии ядра с MKAKU41, также демонстрируют внутренние структуры, как показано на рисунке 1 для ядер, контрастно окрашенных с помощью DAPI. Чтобы подтвердить, что NCh2 и NCh3 были локализованы на периферии ядра, мы провели коэкспрессию NCh2 или NCh3 с AtCRWN1 (дополнительная фигура 1). Совместная локализация NCH с CRWN подтвердила, что NCh2 и NCh3 действительно локализуются на периферии ядра при временной экспрессии в N.Бентамиана . Интересно, что MKAKU41 показал маркировку ядерной оболочки и маркировку внутреннего ядра в большинстве клеток, включая инвагинации мембраны (рис. 1А, белые стрелки), как это было описано для арабидопсиса KAKU4 при экспрессии под контролем промотора 35S (Goto et al., 2014). . К ним относятся внутренние структуры и круглые кольцеобразные инвагинации внутри ядра. Структуры, помеченные MKAKU41, колокализованы с более яркими участками окрашивания DAPI, что указывает на то, что MKAKU41 может ассоциироваться с гетерохроматином.В кольцеобразных инвагинациях отсутствовало внутреннее окрашивание DAPI, и поэтому они были лишены типичного нуклеоплазматического хроматина. Интересно, что гомолог CRWN1 NCh2 сам по себе также вызывает эти выглядящие аберрантными внутриядерные структуры (рис. 1А, белая стрелка), хотя и в меньшей степени, чем MKAKU41. Однако NCh3, гомолог CRWN4 (Ciska et al., 2019), не индуцирует кольцевидные инвагинации. NCh2 и NCh3 также демонстрировали разные пропорции подвижности на периферии ядра (рисунок 1B и дополнительные рисунки 1B-F), как определено восстановлением флуоресценции после фотообесцвечивания (FRAP).NCh3 был значительно менее подвижным (мобильная фракция 16%), чем NCh2 (49% подвижности), что указывает на то, что они могут взаимодействовать с различными белковыми комплексами или структурами. Меньшая подвижность NCh3 по сравнению с NCh2 согласуется с его пониженной способностью реконструировать мембрану ядерной оболочки и вызывать инвагинации (Рис. 1). Большая неподвижная фракция NCh3, но не NCh2, была сравнима с таковой у AtCRWN1 (Graumann, 2014).

Рисунок 1. Белки кукурузы NCh2, NCh3 и MKAKU41 локализуются в ядерной оболочке. (A) Конфокальная визуализация N. benthamiana , временно экспрессирующих NCh2, NCh3 и MKAKU41 в виде слитых флуоресцентных белков (зеленый/пурпурный) и ядер, меченных DAPI (синий). И MKAKU41, и NCh2 показывают ядерные инвагинации (белые стрелки) и маркировку на ядерной оболочке (белые прямоугольники). NCh3 имеет преимущественно ядерную периферическую локализацию. Масштабная линейка обозначает 5 мкм. (B) Анализ FRAP показывает, что NCh2 имеет большую подвижную фракцию, чем NCh3 на периферии ядра. n ≥ 30 ядер в трех экспериментальных повторах.

Было продемонстрировано, что степень инвагинации и деформации ядра зависит от уровня экспрессии KAKU4 у A. thaliana (Goto et al., 2014). Поэтому мы спросили, сохранилась ли эта причинно-следственная связь в генах кукурузы, MKAKU41, NCh2 и NCh3, используя анализы переходной экспрессии доза-реакция, обобщенные на рисунке 2. Мы инфильтрировали N. benthamiana с тремя различными концентрациями Agrobacterium, OD 0 .01; , тип II для незначительных инвагинаций или включений в ядре и тип III для крупных инвагинаций и деформации ядра. Эта классификация помогла провести сравнительный анализ серьезности изменений ядерной морфологии в различных экспериментах, использованных в этом исследовании.Увеличение инфильтрационной концентрации NCh2 приводило к прогрессивно увеличивающейся деформации ядра, иллюстрируемой увеличением паттерна типа II и появлением типа III при самой высокой дозе трансфекции (рис. 2А). NCh3 также показал зависимое от дозы трансфекции увеличение ядерной аберрации в сочетании с увеличением типа II, но в меньшей степени и без каких-либо ядер типа III даже при самой высокой дозе (рис. 2B). Для MKAKU41 увеличение концентрации трансфицирующей плазмиды приводило к тому, что большинство ядер, первоначально демонстрирующих только периферическую локализацию, чуть меньше половины демонстрировали паттерны типа III с тяжелыми инвагинациями, наблюдаемыми при самой высокой концентрации (рис. 2C).Мы интерпретируем эти результаты как установление того, что, поскольку все три протестированных белка показали, что они могут вызывать дозозависимое усиление тяжести паттернов ядерной деформации, все они могут рассматриваться как часть одного и того же процесса, необходимого для правильной организации ядерной периферии. компартмент в интерфазных ядрах.

Рисунок 2. Концентрация НЧ2, НЧ3 и МКАКУ41 влияет на уровень инвагинации и разрушения ядер. Конфокальная визуализация живых клеток NCh2, NCh3 и MKAKU41 показывает, что увеличение концентрации NCh2 и MKAKU41 увеличивает разрушение ядер.Ядра были классифицированы в соответствии с (Goto et al., 2014) на тип I, нормальная локализация ядерной оболочки; Тип II, незначительные инвагинации и локализация преимущественно ядерной оболочки; или Тип III, серьезное нарушение структуры ядра. (А) НЧ2, (Б) НЧ3 и (С) МКАКУ41. Масштабная линейка обозначает 5 мкм. n ≥ 30 ядер в трех экспериментальных повторах.

Совместная экспрессия NCh2 или NCh3 с MKAKU41 показала синергетический эффект на фенотипы инвагинации и деформации ядра

Ранее было показано, что арабидопсис CRWN1 и KAKU4 вызывают повышенную ядерную деформацию и инвагинации при совместной экспрессии (Goto et al., 2014). Чтобы определить, одинаково ли гомологи кукурузы влияют на путь организации ядра, мы совместно экспрессировали MKAKU41 либо с NCh2, либо с NCh3, как показано на рисунке 3. При совместной экспрессии инвагинации и деформации ядер были значительно усилены по сравнению с одиночной экспрессией Рисунок 3А). Количественно оценивая наиболее тяжелый фенотип (тип III), мы обнаружили, что только NCh2 проявлял 7%, а только MKAKU41 — 42%. Однако комбинация NCh2 и MKAKU41 показала 88% тип III, что значительно превышает общее значение 49% и, таким образом, является синергетическим для этого измерения. Точно так же коэкспрессия NCh3 и MKAKU41 достигла уровня 66% ядер типа III, что значительно больше, чем 42% суммы уровней однократной экспрессии. Следовательно, белки NCH, по-видимому, действуют совместно с MKAKU41, влияя на организацию ядерной периферии, судя по изменениям в их паттернах локализации. Этот кумулятивный эффект на структуру ядра предполагает, что NCh2/NCh3 и MKAKU41 могут действовать в одном и том же белковом комплексе. Мы проверили эту идею, проверив доказательства взаимодействия между NCH и MKAKU41 в planta с использованием акцепторного фотообесцвечивания флуоресцентного резонансного переноса энергии (apFRET).Значительное повышение эффективности FRET указывало бы на взаимодействие, и оно было измерено, когда NCh2 и NCh3 коэкспрессировались с MKAKU41, по сравнению с невзаимодействующим контролем, калнексином (рис. 3C). Значения% эффективности FRET внутреннего контроля были очень низкими, как и ожидалось для неотбеленных контролей (дополнительная таблица 1). Это продемонстрировало, что NCh2 и NCh3 могут взаимодействовать с MKAKU41, и согласуется с их синергетическим эффектом на уровни ядерных деформаций. Это наблюдение аналогично тому, что наблюдалось для гомологов Arabidopsis с использованием двухгибридной системы дрожжей и растительной экспрессии (Goto et al., 2014). Важно отметить, что наши результаты предоставляют доказательства живых изображений для в planta взаимодействий между этими белками на ядерной периферии.

Рисунок 3. Коэкспрессия NCh2 или NCh3 с MKAKU41 усиливает ядерные инвагинации, а NCh2 и NCh3 взаимодействуют с MKAKU41. (A) Конфокальные изображения N. benthamiana , коэкспрессирующих NCh2 или NCh3 с MKAKU41. (B) Количественная оценка ядерной морфологии для ядер, экспрессирующих одиночные MKAKU41, NCh2, NCh3; или коэкспрессию NCh2 или NCh3 с MKAKU41; подразделяются на типы I, II или III, как показано на рисунке 2.Масштабная линейка обозначает 5 мкм. (C) Эффективность apFRET (%) демонстрирует в planta взаимодействий NCh2 и NCh3 с MKAKU41 по сравнению с контролем (CNX). Сплошные линии под графиками обозначают отрицательный контроль, заштрихованный положительный контроль. Ключевые статистические сравнения показаны и более полно сведены в таблицу в дополнительной таблице 1. Красная линия обозначает среднее значение, синее стандартное отклонение. Выполнен однофакторный статистический тест ANOVA. **** р ≤ 0,0001. n ≥ 30 ядер, полученных в трех экспериментальных повторах для всех описанных экспериментов.

Сверхэкспрессия MKAKU41 ремоделировала другие белки внутренней и внешней ядерной мембраны

И AtKAKU4, и MKAKU41 вызывают деформацию NE и нарушение структуры ядер при коэкспрессии с AtCRWN1 (Goto et al., 2014), NCh2 или NCh3 (Fig. 3). Чтобы дополнительно исследовать, затрагивает ли это весь NE, мы спросили, может ли сверхэкспрессия MKAKU41 привести к инвагинации других белков, которые ранее не тестировались, но, как известно, локализуются либо в INM, ONM, либо в ER.Для этого мы использовали AtSUN2-YFP для маркировки INM, ZmMLKP1-GFP для маркировки ONM и калнексин-GFP для маркировки мембраны ER. На рис. 4 показано, что каждый из этих маркеров показал нормальную локализацию на периферии ядра при индивидуальной экспрессии. Однако при коэкспрессии с MKAKU41 все эти белки появлялись в аберрантных внутриядерных структурах. Следовательно, экспрессия MKAKU41, по-видимому, вызывает интернализацию всего NE, включая мембранный маркер calnexin-GFP ER, демонстрируя, что MKAKU41-индуцированные деформации и инвагинации ядер не ограничиваются нуклеоплазматическими белками и белками INM LINC.

Рисунок 4. MKAKU41-индуцированные ядерные инвагинации включают другие белки, локализованные в ядерной оболочке и ER. (A) Конфокальная визуализация, показывающая, что маркеры внешней ядерной мембраны кукурузы MLKP1, белки ядерной оболочки арабидопсиса SUN2 и SUN2ΔNterm и маркер мембраны ER CNX включаются в инвагинации при совместной экспрессии с MKAKU41. Рядом с конфокальными изображениями указан процент ядер, которые демонстрируют деформации, классифицированные ранее. (B) SUN2 и SUN2ΔNterm демонстрируют различное встраивание в ядерные инвагинации, индуцированные MKAKU41. На графиках показаны нормализованные профили линий размером 4 мкм над инвагинациями SUN2 или SUN2ΔNterm (сплошные белые линии) и ядерной мембраной (белые пунктирные линии). Расположение профилей линий можно увидеть на конфокальных микрофотографиях. (C) Соотношение флуоресценции субпериферии/полного ядра SUN2 и SUN2ΔNterm при экспрессии отдельно или с MKAKU41. Выполнен однофакторный статистический тест ANOVA; **** р ≤ 0.0001. n ≥ 30 для каждого условия.

Ранее было показано, что AtSUN1 и AtSUN2 взаимодействуют с AtCRWN1, опосредованно N-концом SUN (Graumann, 2014), и что делеционная конструкция SUN2ΔNterm может нарушать взаимодействие SUN-CRWN (Graumann et al., 2010; Graumann, 2014). ). Чтобы более конкретно исследовать роль комплекса LINC в производстве этих аберрантных ядерных структур, мы сверхэкспрессировали SUN2ΔNterm как способ отменить связывание CRWN-SUN и тем самым, возможно, уменьшить взаимодействие MKAKU41 с комплексом LINC.Примечательно, что коэкспрессия SUN2-MKAKU41 приводила в основном к ядрам типа III, тогда как коэкспрессия SUN2ΔNterm-MKAKU41 приводила к меньшей деформации, при этом ядра демонстрировали в основном фенотип II типа (рис. 4А). Интересно, что флуоресцентное мечение ядерной оболочки полноразмерного SUN2 оказалось ниже, чем у SUN2ΔNterm, при совместной экспрессии с MKAKU41 (рис. 4A, B). Профили линий интенсивности сигнала, проведенные над областями инвагинации ядра (рис. 4А, пунктирная линия) или ядерной оболочки (рис. 4А, сплошная линия), показали, что сигнал полной длины SUN2 был намного сильнее внутри инвагинаций, но ниже на ядерной оболочке по сравнению с теми от флуоресценции SUN2ΔNterm (рис. 4B).Мы количественно оценили влияние коэкспрессированного MKAKU41 на тенденцию SUN2 к периферическому окрашиванию, определив процент сигнала внутри по сравнению со всем ядром (субпериферия/все ядро/, дополнительная фигура 2). Например, если бы сигнал был полностью периферийным, процент был бы равен или близок к нулю. На фигуре 4C показано увеличение внутренней флуоресценции для SUN2 при коэкспрессии SUN2-MKAKU41 по сравнению с одним SUN2 ( p <0,0001). Следовательно, полноразмерный SUN2 перемещается от периферии ядра при коэкспрессии с MKAKU41. Относительная внутренняя флуоресценция ядра также увеличивалась при коэкспрессии SUN2ΔNterm с MKAKU41 ( p <0,001), но в меньшей степени, чем для полноразмерного SUN2 ( p <0,001). Эти наблюдения указывают на участие комплекса LINC и, более конкретно, нуклеоплазматического N-концевого домена белка NE, SUN2, в формировании аберрантных MKAKU41-зависимых внутриядерных структур.

Нарушение закрепления ядерного актина усиливает инвагинацию ядер

В дополнение к белку SUN2 NE, который охватывает INM и имеет непосредственный контакт с нуклеоплазмой, мы также исследовали продуцент ONM, MLKS2, и его производное с делецией домена ARM, для которого ранее было показано нарушение связывания актина (Gumber et al., 2019б). При совместной экспрессии с MKAKU41 маркер ONM MLKS2 также появлялся во внутриядерных структурах, подобных инвагинациям, как показано на фиг. 5А. При совместной экспрессии MKAKU4 и MLKS2ΔARM наблюдались деформации ядер и инвагинации (рис. 5A), которые оказались гораздо более серьезными и обильными (рис. 5B) по сравнению с таковыми при совместной экспрессии MKAKU4 и полноразмерного MLKS2. Следовательно, белок ONM KASH MLKS2 перемещается во внутриядерные структуры за счет коэкспрессии MKAKU41, а потеря взаимодействующего с актином домена ARM усугубляет ситуацию и вовлекает цитоплазматический F-актин в ремоделирование NE и ядерной периферии.

Рисунок 5. Заякоривание актина в ядре важно для регуляции деформации ядра при сверхэкспрессии MKAKU41. (A) Конфокальная визуализация живых клеток MLKS2 и MLKS2ΔARM, одиночная экспрессия и коэкспрессия с MKAKU41. (B) Все визуализированные ядра были классифицированы по уровню разрушения, как описано ранее. (C) Количество инвагинаций ядер при разных уровнях экспрессии MKAKU41 с деполимеризованным актином (LatB). (D) Соотношение флуоресценции субпериферических и целых ядер ядер, экспрессирующих различные уровни MKAKU41 (MK, от 0 до 0.1) с деполимеризацией актина и без нее (LatB). Ядра визуализировали с помощью маркера NE LBR-GFP. Масштабная линейка обозначает 5 мкм. n ≥ 30 ядер, полученных в трех экспериментальных повторах для панелей A () и B (). Для панелей C и D выполняли односторонний статистический тест ANOVA; ns p ≥ 0,05, * p ≤ 0,05, *** p ≤ 0,001 и **** p ≤ 0,0001. n ≥ 60 в трех биологических повторностях.

Чтобы дополнительно исследовать взаимодействие между околоядерным актином и MKAKU41-индуцированными деформациями ядра, мы использовали Latrunculin-B (LatB) для деполимеризации актинового цитоскелета, как описано ранее (McKenna et al., 2019). На рисунке 5C показано, что при экспрессии MKAKU41 на умеренном уровне (OD 0,05) деполимеризация LatB актинового цитоскелета приводила к статистически значимому увеличению числа инвагинаций ( p ≤ 0,001). В то время как эта тенденция существовала при более низких (О.D. 0,01) и более высокие концентрации трансфекции (O.D. 0,10), это не было статистически значимым. Чтобы дополнительно изучить связь между актиновым цитоскелетом и деформациями ядра, вызванными MKAKU41, мы изучили соотношение внутренних и периферических сигналов (дополнительная фигура 2) и обнаружили, что деполимеризация актина количественно смещает маркер INM NE, LBR, в сторону увеличения внутреннего сигнала (рисунок 5D) . Тот же самый эффект наблюдался и оказался статистически значимым для двух концентраций инфильтрата MKAKU41 (O.Д. 0,01) ( р = 0,01) и 0,05 ( р = 0,05). Это демонстрирует, что при умеренной концентрации трансфекции (OD 0,05) деполимеризация актина с помощью LatB увеличивает интернализацию периферических маркеров. Эти результаты подтверждают данные экспериментов MLKS2ΔARM, поскольку они предполагают F-actin как возможный фактор, который может обеспечивать противодействующую силу или противовес нуклеоскелетным белкам, которые могут инвагинировать NE и создавать тельца включения в зависимости от концентрации.

Нарушение транспозона гена MKAKU41 косегрегирует с фенотипическими эффектами на форму и развитие ядра

Увидев, что сверхэкспрессия MKAKU41 кукурузы у видов эвдикотов приводит к нарушению ядерной архитектуры и серьезному смещению ядерной оболочки, мы хотели изучить роль этого гена в его нативном генетическом фоне, кукурузе. В рамках проекта мутагенеза транспозонов UniformMu мы обнаружили и охарактеризовали аллель MKAKU41 , меченный мутатором, что позволило провести генетическое исследование биологических последствий нарушения генов у кукурузы.

Аллель с транспозонной меткой, обозначенный здесь mkaku41 , и его аналог дикого типа, MKAKU41 , показаны на рисунке 6. как связанный с тремя моделями транскриптов. Структура гена для модели транскрипта T01 (рис. 6A) охватывает 7,9 т.п.н., с 11 экзонами, продуцирующими мРНК с одной большой ORF, которая, по прогнозам, кодирует белок размером 579 AA. Сайт вставки транспозона (mu1005806) расположен в 5′ UTR (рис. 6B).Аллель вставки транспозона был охарактеризован геномным ПЦР-анализом (фиг. 6C) с использованием различных комбинаций праймеров, которые фланкировали сайт вставки и были ген-специфичными и Mutator -специфичными (фиг. 6A, праймеры F, T, R). Эти продукты ПЦР визуализировали (рис. 6C) и секвенировали (рис. 6D) от предшественника дикого типа W22 (W22+), а также особей F2 из семей, расщепляющихся по mkaku41 (+/+, ± или -/-), где символ «-» обозначает аллель вставки транспозона. Эти праймеры для ПЦР и гель-продукты для ПЦР использовали для генотипирования растений в последующих анализах.

Рисунок 6. Генная структура аллелей дикого типа и меченных транспозоном аллелей MKAKU41 . (A) Модель гена MKAKU41 (модель транскрипта «T01») с указанием положения экзонов (черные прямоугольники), интронов (серые), 5′- и 3′-UTR, вставки транспозона (Mu), транспозон-специфического Праймеры для ПЦР Tir6 (стрелки T) и праймеры для ПЦР, специфичные для Mu-фланкирующих генов (стрелки F, R). (B) Схема сайта вставки MuDR в 5′-UTR длиной 95 п.н., показывающая расположение повтора сайта-мишени длиной 9 п.н. (зеленый, 64–72 п.н. в модели транскрипта mkaku41-T01) и последовательность запроса длиной 25 п.н. (желтый) используется для анализа транскриптов. (C) ПЦР-генотипирование на наличие или отсутствие аллеля с меткой Mu. Продукты ПЦР с использованием различных пар ген-специфичных (F, R) или транспозон-специфических пар праймеров (T). Маркер размера 100 п.н. в агарозном геле, окрашенный бромистым этидием (дорожка M), и продукты ПЦР одного растения (другие дорожки) из W22 + или выберите братьев и сестер mkaku41 F2 для иллюстрации дикого типа (+/+), гетерозиготного (±) или мутантного (-/-) Паттерны генотипов ПЦР из ПЦР (стрелки справа от геля). (D) Последовательности клонированных и секвенированных ампликонов выровнены и показывают сегреганты предшественника W22 (ссылка W22) и F2. Было обнаружено, что + / + особи из запасов мутагенеза транспозонов являются гетерозиготными по инделю (-) длиной 2 п.н. Указаны последовательности, соответствующие запрашиваемой последовательности длиной 25 п.н. (выделено желтым цветом), сайту вставки длиной 9 п.н. (выделено зеленым цветом), транспозону (строчные буквы, гранатовый текст) и стартовому кодону (ATG подчеркнуто). Инсерция Mu произошла в аллеле с делецией 2 п.н. и привела к фланкирующей дупликации сайта-мишени размером 9 п.н. (E) Анализ транскриптома, специфичного для цепи, обобщается для идеального совпадения вхождений запрашиваемой последовательности в библиотеках, полученных из растений дикого типа (вверху) или мутантных (внизу) растений. Все смысловые транскрипты мутантного аллеля имели чрезвычайно короткую (∼21 п.н. или менее) 5’UTR.

Путем проверки последовательностей соединения между эталонным геномом W22 дикого типа и транспозоном (рис. 6D, строчные буквы) мы идентифицировали дупликацию сайта-мишени длиной 9 п.н. как CTCCTCTC (зеленый цвет на рис. 6).Эти результаты подтвердили, что транспозон был встроен в 5′-UTR в положении 23 п.н. выше стартового кодона, нарушая большую часть 95-н.п. 5′-UTR дикого типа. Расположение этой вставки, хотя и не в кодирующей белок области гена, находится в пределах первого экзона, и поэтому ожидается, что ее расположение нарушит экспрессию или структуру транскрипта гена. Неожиданно, из анализа транскриптома мы обнаружили, что уровни экспрессии гена для MKAKU41, измеренные как общее нормализованное считывание по модели гена, были сходными в библиотеках, полученных из листьев и метелок дикого типа и мутантов.Мы изучили данные транскрипта, чтобы исследовать влияние вставки транспозона на область 5′-UTR путем поиска присутствия уникальной последовательности 5′-UTR длиной 25 п. выделено желтым цветом). Мы обнаружили в общей сложности 70 совпадений с нашей последовательностью запроса длиной 25 п.н. в нашем транскриптоме, который был секвенирован на глубине более 100 млн прочтений на комбинацию генотипа ткани (рис. 6Е). Все 70 вхождений запрашиваемой последовательности были из библиотек дикого типа, за исключением одного, который находился на обратной цепи по отношению к гену (фиг. 6Е).Эти результаты показывают, что 5’-UTR действительно был нарушен у мутантных растений. В дополнение к этому подробному анализу MKAKU41, некоторые дифференциально экспрессируемые гены (дополнительная таблица 2) наблюдались у мутантных листьев по сравнению с листьями дикого типа и цельной метелкой, обогащенной мейотиками, но анализ онтологии генов не выявил каких-либо четких и воспроизводимых обогащений, которые отличались бы от тех рандомизированных контролей.

Затем мы исследовали фенотипические последствия вставки транспозона mkaku41 на ядра корневых волосков, устьичный комплекс и жизнеспособность пыльцы, как показано на рисунке 7. Ядра корневых волосков у проростков W22 + (нормальные) и mkaku41 мутантов через 5 дней после набухания были визуализированы, и их форма была проанализирована (рис. 7A–F). Мутантные ядра были визуально и количественно более округлыми, чем их аналоги дикого типа. Мутантные ядра имели среднюю максимальную длину 22 мкм, тогда как их аналоги дикого типа имели среднюю длину 34 мкм (рис. 7G). Мутантные ядра также демонстрировали более высокий индекс округлости, чем ядра дикого типа (рис. 7H). Обе меры ( n = 50) были статистически значимыми, как определено с использованием T -критерия, двустороннего с p <0.0001.

Рисунок 7. Соматические фенотипы mkaku41 . Окрашенные DAPI ядра корневых волосков проростков W22+ (A–C) и mkaku41 (D–F) . (G) Наибольший диаметр ядер корневых волосков W22+ и mkaku41 ( n = 50). (H) Измерения индекса ядерной округлости с использованием 4π (площадь/периметр 2 ), где 1 = идеальный круг, ядер корневых волосков W22 + и mkaku41, рассчитанных с использованием Фиджи. (I) Зрелый устьичный комплекс в листе, окрашенном W22 + DAPI, где две центральные гантелевидные замыкающие клетки (GC) окружены двумя вспомогательными клетками (SC). (J–N) Репрезентативные изображения устьичных комплексов mkaku41 DAPI-окрашенных листьев. Стрелки указывают на лишние или неправильно расположенные вспомогательные клетки. Шкала баров составляет 10 мкм. ***** Стьюдента t — критерий двусторонний, p < 0,0001. (O–Q) Дифференциальное окрашивание пыльников для проверки жизнеспособности пыльцы от W22+ (O) и mkaku41 -/- (P,Q) метелки, окрашенные модифицированным красителем Александера, где жизнеспособные пыльцевые зерна выглядят пурпурными, а недоразвитые пыльцевые зерна кажутся зелеными.2) рассчитано для пыльников W22+ и мкаку41-/- с помощью Фиджи. Шкала баров составляет 50 мкм. ***** Стьюдента t — критерий двусторонний, p < 0,0001.

Затем мы проанализировали два надземных фенотипа, внешний вид устьичных комплексов и пыльцу. У растений W22+ нормальный устьичный комплекс состоит из двух замыкающих клеток, окруженных двумя вспомогательными клетками, как показано для W22+ (рис. 7I). Напротив, у мутантных растений устьичные комплексы неправильной формы, состоящие из двух нормально выглядящих замыкающих клеток, окруженных одной или двумя дополнительными и неправильно расположенными вспомогательными клетками (стрелки, рис. 7J-N).Для фенотипов пыльцы мы проанализировали жизнеспособность и форму (рис. 7O–R). Используя модифицированный метод дифференциального окрашивания Александера, мы обнаружили, что процент жизнеспособной пыльцы у мутанта был резко снижен с 84 до 46%. Форма пыльцы также была затронута у мутанта, где средняя степень округлости уменьшилась с 0,93 до 0,7. Обе меры ( n > 1000 для окрашивания, n = 100 для округлости) были статистически значимыми, как определено с использованием двустороннего T -критерия с p <0.0001.

В совокупности эти данные показывают, что мутация mkaku41 была связана с множественными фенотипами, включая форму ядер корневых волосков, развитие устьичных комплексов и жизнеспособность пыльцы. Следовательно, MKAKU41, по-видимому, действует в некоторых из тех же генетических путей, что и связанные с NE комплексные белки LINC, такие как SUN и KASH. Эти генетические данные у кукурузы интересны, если учесть наши данные о том, что гетерологичные фенотипы сверхэкспрессии и возмущения актина (Рис. 1-5) нарушают ядерную архитектуру и организацию ядерной оболочки.В совокупности все эти эксперименты устанавливают биологическую роль MKAKU41, NCh2 и NCh3 как ядерно-скелетных белков, которые регулируют фундаментальные ядерные процессы в клеточной структуре и функции.

Обсуждение

Регуляция размера и формы ядра важна для многих фундаментальных клеточных процессов у всех эукариот. Ядерная архитектура контролируется множественными взаимодействиями с участием NE, связанных с NE комплексов и нуклеоскелета. Здесь мы охарактеризовали множественные нуклеоскелетные белки кукурузы, которые, как и их аналоги у животных, контролировали ядерную динамику.Всеобъемлющая цель, мотивирующая это исследование, состоит в том, чтобы установить общие правила, применимые к растительной области, обширному эволюционно пространству. С этой целью мы использовали анализ транзиторной гетерологичной экспрессии табака в качестве мощной и универсальной экспериментальной платформы для исследования ядерной оболочки растений. В этом исследовании и ранее мы установили клеточную локализацию, белок-белковые взаимодействия, фенотипы доза-реакция и визуализацию живых клеток, что позволяет проводить кимографический анализ, подвижность через FRAP и взаимодействия через AP-FRET, все из которых позволили и ускорили наше понимание биологии NE трав и модельных культур (Gumber et al., 2019а,б).

Ядерные скелетные белки кукурузы, изученные в этом исследовании, представляют собой NCh2, NCh3 и MKAKU41, каждый из которых имеет один или несколько гомологов (рис. 1A) у видов эвдикотов (Gumber et al., 2019a), и все они демонстрируют ядерную локализацию и обогащение NE у эвдикотов. гетерологичные системы экспрессии. Данные взаимодействия из этого (рис. 3C) и предыдущих исследований также указывают на то, что эти белки связаны с NE через комплекс LINC. Эти результаты, наряду с данными, полученными по другим видам растений, указывают на широкую консервативность нуклеоскелетных белков растений у покрытосеменных растений (Goto et al., 2014; Мейер и др., 2017; Циска и др., 2019; Сакамото, 2020). Функциональная консервация этих компонентов подтверждается ранее сообщавшимся межвидовым функциональным восстановлением (Gumber et al., 2019b) и текущим исследованием, в котором мы показываем, что кукуруза MKAKU41 (рис. 4) взаимодействует с Arabidopsis AtSUN2, вызывая изменение ядерной локализации арабидопсис AtSUN2.

Многочисленные доказательства сохранения растительных комплексов LINC также наблюдаются на организменном и фенотипическом уровне.Например, мы (рис. 7) и другие обнаружили, что мутантные фенотипы обычно включают округление ядер корневых волосков, нарушение развития устьичного комплекса и влияние на форму и жизнеспособность пыльцы (Dittmer et al., 2007; Goto et al., 2014, 2020; Zhou et al., 2014; Gumber et al., 2019b; Newman-Griffis et al. , 2019). Дефекты формы ядра в корневых волосках стали отличительной чертой дефектов LINC у растений, и как таковые были предсказаны. Однако фенотипы устьичного комплекса и формы пыльцы ранее не наблюдались у растительных мутантов генов MKAKU4, но они в некоторой степени напоминают таковые у растительного мутанта KASH, mlks2 (Gumber et al., 2019б). Чтобы получить генетическое представление об этих нуклеоскелетных белках кукурузы, мы провели поиск аллелей MKAKU41, NCh2 и NCh3 с нарушением транспозонов. Из них мы обнаружили, что ген MKAKU41 , как сообщается, имеет вставку мутатора (McCarty and Meeley, 2009), описанную здесь как первый известный мутантный аллель, mkaku41 . Место вставки находилось в 5′-UTR (рис. 6), обычном месте для вставки Mu (Zhang et al., 2020). Обилие транскриптов не было значительно снижено у мутантов, но мутантный аллель продуцировал чрезвычайно укороченную 5′-UTR длиной 23 п.н. или меньше.Учитывая, что недавно было определено, что медиана длины 5′-UTR у кукурузы составляет 132 п. н. (Leppek et al., 2018), такая чрезвычайно короткая 5′-UTR у мутантов mkaku41 может отменять или значительно снижать способность клетки использовать нативный стартовый кодон для трансляции полноразмерного белка. Если мутантная 5′-UTR слишком коротка для эффективной сборки и сканирования рибосом, следующий стартовый кодон в рамке находится значительно дальше вниз по течению, что приведет к потере первых 125 АК.Кроме того, в мутантной 5’UTR могут отсутствовать регуляторные последовательности мРНК в первых примерно 70 основаниях полноразмерного транскрипта. Необходимы дальнейшие генетические и экспериментальные анализы с новыми аллелями, редактирование генов или применение специфических биотических или абиотических стрессов, чтобы лучше понять, как эти нуклеоскелетные белки растений функционально взаимодействуют с геномами, которые они помогают организовать.

Регуляция ядерной морфологии и внутриядерной организации была дополнительно изучена, чтобы получить представление о механизме, с использованием анализа транзиентной экспрессии табака с флуоресцентно меченными белками и количественного микроскопического анализа. Мы использовали этот подход для изучения множества аспектов замечательного нарушения ядерной архитектуры, вызванного избыточной экспрессией каждого из трех исследованных белков нуклеоскелета кукурузы. Тяжесть нарушения ядра и инвагинации NE увеличивалась за счет совместной сверхэкспрессии двух компонентов (например, MKAKU41 с NCh2 или NCh3) или за счет увеличения концентрации трансфицирующих плазмид, что, как ожидается, повысит уровни их экспрессии. Эти результаты (рисунок 2) и предыдущие исследования растений и животных показывают, что правильная концентрация белка нуклеоскелета может быть основным фактором, определяющим общую ядерную архитектуру (Goto et al., 2014; Легартова и др., 2014; Йоргенс и др., 2017).

В дополнение к обилию белка компоненты ядерных инвагинаций были протестированы на присутствие белков LINC и ER. Зная, что белки SUN взаимодействуют с белками ONM KASH как часть основного комплекса LINC, мы проверили, отражают ли внутриядерные очаги MKAKU41-FP белковые агрегаты всего NE, проверяя колокализацию с двумя типами маркеров, которые находятся в NE, но не в ядре. комплекс LINC или в мембране ER.Все они, включая множественные маркеры ONM, колокализованы с аберрантными внутриядерными структурами (Рисунки 4, 5), демонстрируя, что эти внутриядерные структуры содержат компоненты как INM, так и ONM ядерной оболочки. Эти инвагинации ядер растений могут, следовательно, содержать весь протеом NE, а также ассоциированный с NE хроматин, который обычно ограничивается ядерной периферией. Такие инвагинации, как известно, встречаются у растений и животных, у которых могут быть бороздки, деформации, актин или ЭР в стабильных структурах, наблюдаемые как глубокие инвагинации (Collings et al., 2000; Шермелле и др., 2008). Интересно, что инвагинации и деформации мембран, вызванные MKAKU41, также в некоторой степени напоминают деформации ядер животных, связанные с неправильной экспрессией ламина-А (Lammerding et al., 2004; Schreiber and Kennedy, 2013; Swift et al., 2013; Legartová et al. ., 2014).

В нашей экспериментальной установке мы разрушили комплекс LINC в двух разных соединениях, чтобы исследовать влияние этих нарушений на структуру NE. Первый, SUN2ΔN, разорвал связь между LINC и ядерным скелетом; второй MLKS2ΔARM разорвал соединение LINC с цитоскелетом.Весьма интересно, что эти два нарушения оказывали противоположное влияние на тяжесть инвагинаций. Наш анализ делеции домена показал, что нарушение соединения LINC-ядерный скелет уменьшило тяжесть (рис. 4A), тогда как предотвращение соединения LINC-к цитоскелету увеличило серьезность инвагинаций (рис. 5). Это имеет важное механобиологическое значение для идеи о том, что форма ядер растений включает баланс сил между актин-ядерными взаимодействиями и нуклеоскелетными компонентами.Интересно, что AtKAKU4, белки KASH арабидопсиса WIP и ассоциированный с NE миозин участвуют в миграции ядер в различных клеточных процессах, таких как рост пыльцевых трубок (Meier et al., 2017; Goto et al., 2020), что также включает изменения в динамике актина.

Перемещение ядра оказывает физическое давление на НЭ, и ожидается, что противоположные силы компонентов LINC (ядерного и цитоскелетного) будут важны для поддержания целостности и стабильности НЭ (Enyedi and Niethammer, 2017). Контрастные эффекты на целостность NE, которые мы наблюдаем в этом исследовании, являются индикатором того, что компоненты нуклеоскелета кукурузы могут быть функционально связаны именно с таким процессом перетягивания каната, который проявляется как регуляция формы ядра. Многочисленные доказательства согласуются с этой идеей, в том числе превращение ядер в сферические, вызванное генетическим нокаутом миозина, локализованного в ядерной оболочке (Tamura et al., 2013), и округление ядер корневых волосков, вызванное кукурузой mlks2. Мутация (Gumber et al., 2019б). В этом направлении наше исследование дополняет растущее количество свидетельств того, что растения задействуют общий механизм формирования ядра, в котором баланс сил достигается за счет компонентов, взаимодействующих с LINC по обе стороны от NE, обеспечивая его структуру и функционирование в качестве гибкого ячеистая перегородка. В текущем исследовании мы отмечаем несколько признаков (рис. 5), которые поддерживают эту схему типа перетягивания каната. Эти идеи согласуются с результатами исследований на млекопитающих, которые определяют роль комплекса LINC в опосредовании механических взаимодействий между цитоплазмой и ядром (Alam et al., 2016; Йоргенс и др., 2017; Агравал и Леле, 2019 г.; Бузид и др., 2019; Хиеда, 2019).

Предыдущие исследования CRWN и KAKU4 были сосредоточены на структуре хроматина и ядерной архитектуре (Dittmer et al., 2007; Grob et al., 2014; Hu et al., 2019), но наши исследования показывают, что нарушения нуклеоплазмы также могут влиять на нормальное развитие. процессов, что является важным открытием для сельскохозяйственных культур. У животных взаимосвязь между структурной целостностью на клеточном уровне и геномными ответами на процессы окружающей среды и развития все чаще признается как сложный процесс, в котором ламины играют центральную роль (Gerbino et al., 2018). Это исследование расширяет наши знания о нуклеоскелете растений, определяя компоненты и их роли в регулировании фундаментальных динамических процессов ядерной оболочки растений.

Материалы и методы

Клонирование

Генные конструкции

кукурузы и информация о последовательности для клонов, использованных в этом исследовании, перечислены в дополнительной таблице 3. ORF NCh2 была специально синтезирована с Bam HI и Sbf I на 5′- и 3′-концах соответственно (Genscript Biotech). Корпорация, Нью-Джерси).Конструкцию Bam HI-NCh2- Sbf I субклонировали путем рестрикционного клонирования в донорный вектор ECGFP, содержащий eGFP-FLAG-HA (Gumber et al., 2019a, JCB), для создания eGFP-FLAG-HA. Входной вектор NCh2, названный NCh2ec. Аналогично, конструкция Bam HI-NCh3- Pst I была специально синтезирована и субклонирована в донорный вектор ECGFP для создания входного вектора eGFP-FLAG-HA-NCh3, названного NCh3ec. Для конструирования вектора mKAKU41 с помощью Genscript синтезировали Bam HI-mCherry-FLAG-HA-MKAKU41- Bam h2 и клонировали в pUC18 по сайту рестрикции Bam HI.Генную конструкцию mCherry-FLAG-HA-MKAKU41 амплифицировали из этого клонирующего вектора с использованием праймеров KAKUattF (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTA GCAAGGGAGAAGAGG-3′) и KAKUattR (5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAG CCCGTCCCCGT-3′) и вставляли в pDONR2 (Invitrogen), чтобы создать клон записи MKAKU41 с именем MKAKU41ec. Для создания растительных векторов экспрессии конструкции флуоресцентных слитых белков из этих трех входных клонов затем переносили по отдельности в целевой вектор pH7WG2 (Karimi et al., 2002) рекомбинацией Gate LR (Invitrogen).

Для получения положительного контроля p35S:SP-mCherry-GFP-HDEL для apFRET mCherry амплифицировали с помощью ПЦР с полимеразой Q5 (NEB) с использованием праймеров JM403 (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTACAATGAAA GCCTTCACACTCGCTCTTCTTAGCTCTTTCCCTCTATCTCCTGCCCAATCCAGCCATGGGATGCAGGGCGAGGGGAAGGGCGAGGGAAA acctccactgccaccCTTGTACAGCTCGTCC ATGCCG-3′). Праймеры включали как сайт клонирования attB1 Gateway, так и сигнал секреции на 5′-конце, а также 15-нуклеотидный выступ для сборки Gibson на 3′-конце, который содержал аминокислотный линкер GGSGG между mCherry и GFP при слиянии.GFP амплифицировали с использованием праймеров JM367 (5’GGGGACCACTTTGTACAAGAAAGCTGGGTGtcataattcat catGCTTGTACAGCTCGTCCATGCCGAGAG-3′) и JM405 (5’GTACAAGggtggcagtggaggtATGGTGAGCAAGGGCGAGGA GC-3′), которые содержали линкер GGSGG на 5′-конце и мотив удержания HDEL ER. стоп-кодон на 3′-конце. Эти два продукта сливали вместе с использованием ферментной смеси для сборки NEB HIFI Gibson и инкубировали при 50°C в течение 1 часа. Затем проводили реакцию Gateway BP с pDONR221 и последующую реакцию LR с pB7FWG2 для получения конечного вектора.Все этапы подтверждены ПЦР колоний и секвенированием.

Трансформация агробактерий

Конструкции

трансформировали в A. tumefaciens GV3101. Трансформацию проводили путем инкубации плазмидной ДНК и химически компетентной агробактерии на льду в течение 30 мин с последующим 5-минутным холодовым шоком в жидком азоте, затем 5-минутным тепловым шоком при 37°С во вращающемся инкубаторе. После теплового шока добавляли 200 мкл среды LB и инкубировали клетки при 28°C в течение 2 часов. Затем клетки высевали на планшеты LB, содержащие спектиномицин (50 мкг/мл), гентамицин (10 мкг/мл) и рифампицин (25 мкг/мл), и инкубировали в течение 2 дней при 28°С.Затем отдельные колонии собирали, выращивали O/N и трансформировали в N. benthamiana .

Условия роста растений

Растения Nicotiana benthamiana выращивали при цикле свет:темнота 16:8 ч в теплице с температурой 21°C. Возраст инфильтрированных растений составлял 5–6 недель.

Визуализация живых клеток

Представляющие интерес белки

с флуоресцентной меткой временно трансформировали в N. benthamiana , как описано ранее (Sparkes et al., 2006).Впервые описанные здесь конструкции экспрессии белка представляют собой p35S:NCh2-GFP, p35S:NCh3-GFP и p35S:MKAKU41-mCherry. Все остальные маркеры были ранее опубликованы: p35S:GFP-CNX (Irons et al., 2003), p35S:LBR-GFP (Irons et al., 2003), p35S:MLKP1-GFP (Gumber et al., 2019a), p35S:YFP-AtSUN2 (Graumann et al., 2010), p35S:YFP-AtSUN2ΔNterm (Graumann et al., 2010), p35S:MLKS2-GFP и p35S:MLKS2ΔARM-GFP (Gumber et al., 2019b). Культуру агробактерий с оптической плотностью 0,1 использовали во всех условиях, если не указано иное, и клетки визуализировали через 3 дня после трансформации. Комбинации GFP/mCherry визуализировали с помощью конфокального микроскопа Zeiss LSM 800 с переключением линий, возбуждением 488 нм и 561 нм и эмиссией 500–550 нм и 565–620 нм, собранных для GFP и mCherry соответственно. Для визуализации GFP/YFP и YFP/mCherry использовался Zeiss LSM 880 с переключением кадров. Для визуализации GFP/YFP использовалось возбуждение на длинах волн 488 и 514 нм с эмиссией, собранной между 500–550 и 525–560 для GFP и YFP соответственно. Для визуализации YFP/mCherry использовалось возбуждение с длиной волны 514 и 561 нм, а эмиссия регистрировалась в диапазоне 517–560 нм и 561–624 нм соответственно.Для всех изображений, описанных выше, использовалось изображение размером 512 × 512 пикселей с масштабированием сканирования 4 и объективом 63 × 1,4 NA. Все комбинации выполнялись с тремя независимыми повторами эксперимента; показаны репрезентативные изображения. Для восстановления флуоресценции после фотообесцвечивания (FRAP) использовалась линза 100 × 1,4 NA с областью интереса 4 мкм в центре изображения, охватывающей ядро. Перед отбеливанием было выполнено пять сканирований, а затем лазер с длиной волны 488 нм осветлил область интереса, используя 100% пропускание в течение 20 итераций.Образы восстановления затем собирались в течение 1 минуты для наблюдения за восстановлением. Данные были нормализованы, и кривые FRAP были получены, как описано ранее (Martiniere et al., 2012).

Для акцепторного фотообесцвечивания при резонансной передаче энергии Ферстера (apFRET) использовалась линза 100 × 1,4 NA с областью интереса 4 мкм в центре изображения, охватывающей ядро. Было выполнено пять сканирований как с эмиссией/возбуждением GFP, так и с mCherry, а затем конструкция mCherry была обесцвечена в области интереса лазером 561 нм при 100% пропускании в течение 20 итераций.После этого было проведено пять сканирований после отбеливания. Данные были нормализованы, а эффективность apFRET (%) рассчитана, как ранее (Graumann et al., 2010; Graumann et al., 2014; Pawar et al., 2016). Минимум 30 ядер на условие использовали для apFRET в трех экспериментальных повторах. Для определения статистически значимых различий между образцами был выполнен односторонний ANOVA. Для обработки латрункулином-В (LatB) для деполимеризации актинового цитоскелета образцы инкубировали с 25 мкМ LatB в течение 1 часа, так как ранее было показано, что это в достаточной степени деполимеризует актиновый цитоскелет (McKenna et al., 2019). Графики были созданы с помощью графического планшета, как описано в подписях к рисункам. Статистические тесты были выполнены в Graphpad Prism и представляют собой либо ANOVA, либо тест Студента T в зависимости от соответствия набору данных и как указано в подписях к рисункам. Для всех наборов данных NS P ≥ 0,05, * p ≤ 0,05, ** p ≤ 0,01, * p ≤ 0,001 и ** p ≤ 0,0001.

Растительный материал кукурузы и генотипирование

W22 дикого типа, используемый в этом исследовании, представляет собой линию W22 с преобразованной окраской, полученную от Hugo Dooner (Waksman Inst. , Рутгерс, Нью-Джерси, США), полученный Brink (1956). Семенной материал UF-Mu-00395 был получен из Фондового центра сотрудничества в области генетики кукурузы. Растения выращивали в исследовательском центре Mission Road при Университете штата Флорида (Таллахасси, Флорида, США) летом 2017 и 2018 годов и размножали путем ауткроссинга с W22. Осенью 2018 года семена потомства были выращены в теплице в здании King Life Sciences Building (факультет биологических наук, Университет штата Флорида, Таллахасси, Флорида, США).Расщепленные растения подвергали самоскрещиванию для получения мутантных растений из потомства.

ДНК

выделяли из 4-недельных проростков, как описано ранее Gumber et al. (2019б). ПЦР-генотипирование проводили с использованием комбинации геноспецифических прямого (F, 5′-CCCGTGAAGCCGAAGGCAGA-3′) и обратного (R, 5′-CGCCTCACGCTCACGCTCAC-3′) праймеров или транспозон-специфического праймера Tir6 (5′-AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC -3′) в сочетании с праймером F или R. Продукты ПЦР разделяли электрофорезом в агарозном геле и клонировали в векторе pCRTM4Blunt-TOPO (Invitrogen, кат. № K2875-20) путем клонирования ТА.Клоны секвенировали, а последовательности вставок проверяли с использованием векторных праймеров M13F и M13R в Центре молекулярного клонирования Департамента биологических наук Университета штата Флорида. Последовательности были сопоставлены с эталонным геномом W22v2 для проверки сайта вставки транспозона.

Микроскопия кукурузы

Визуализацию корневых волосков кукурузы проводили, как описано Gumber et al. (2019б). Вкратце, корни собирали у 5-дневных сеянцев и фиксировали в течение 1 часа в буфере А (Howe et al., 2013) с добавлением 4% параформальдегида. Небольшие срезы корневой ткани, содержащие корневые волоски, окрашивали 3 мкг/мл DAPI в течение 20 мин при комнатной температуре, помещали в VECTASHIELD и визуализировали на флуоресцентном микроскопе EVOS (Thermo Fisher Scientific). Изображения были обработаны с использованием функции «Анализ частиц» программы ImageJ для измерения максимального диаметра и округлости ядер.

Для визуализации комплекса устьиц растения выращивали в теплице и собирали 4-й лист при его первом появлении. Собранный лист фиксировали в буфере А с 4% параформальдегидом в течение часа при комнатной температуре с вращением. Ткань трижды промывали и хранили в буфере А при 4°С до дальнейшего использования. Ткань листа помещали на предметное стекло, нарезали на мелкие кусочки и окрашивали 3 мкг/мл DAPI в течение 20 мин при комнатной температуре, закрепляли VECTASHIELD и визуализировали на флуоресцентном микроскопе EVOS (Thermo Fisher Scientific).

Окрашивание пыльцевых зерен проводили, как описано ранее Gumber et al.(2019б). Вкратце, мужские цветки собирали до расхождения и фиксировали в фиксаторе Карнуа (спирт 6:3 хлороформ:1 уксусная кислота) в течение как минимум 2 часов при комнатной температуре. Из цветков с помощью микроскальпеля и пинцета выдавливали пыльники на предметное стекло. Окрашивание проводили модифицированным красителем Александера, содержащим малахитовый зеленый (0,01%), кислотный фуксин (0,05%) и оранжевый G (0,005%), как описано, для дифференциации жизнеспособных (пурпурных) пыльцевых зерен от абортированных (зеленых) пыльцевых зерен. Изображения пыльцевых зерен в светлом поле были получены на микроскопе Revolve (Echo Labs). Для определения жизнеспособности пыльцы подсчитывали не менее 300 пыльцевых зерен с 3 растений каждого генотипа. Округлость пыльцы проводили с помощью Fiji.

Выделение РНК и подготовка библиотеки

Расщепленные растения дикого типа и мутантные mkaku41 выращивали в теплице. С 2-недельных растений собирали четвертые листья, а с 6-8-недельных растений собирали мужские цветки в средней профазе на стадии мейоза.Ткани немедленно хранили в жидком азоте. РНК выделяли из трех биологических повторов для каждого генотипа с использованием мини-набора Qiagen RNeasy Plant в соответствии с инструкциями производителя. Целостность РНК проверяли с использованием системы Bioanalyzer (Agilent). Для подготовки библиотеки ввели образец 400 нг общей РНК (определено с помощью реагентов Qubit RNA HS, Thermo) с RIN > 7 (Bioanalyzer RNA Nano, Agilent). Библиотеки готовили на автоматизированной рабочей станции Biomek 400 (Beckman Coulter) с использованием набора NEBNEXT Ultra II RNA Library Prep для Illumina (New England Biolabs) в соответствии с инструкциями производителя, время фрагментации РНК 15 мин, разведение 1/10 Адаптер NEB и 11 циклов ПЦР-амплификации с праймерами с двойной индексацией. Амплифицированные библиотеки первоначально определяли количественно с помощью реагентов Qubit DNA HS, проверяли размер и артефакты с помощью реагентов Bioanalyzer DNA HS, а для определения молярных количеств каждой библиотеки использовали KAPA qPCR (KAPA Biosystems). Отдельные библиотеки разбавляли и объединяли в эквимолярный пул, и пул снова проверяли с помощью Bioanalyzer и KAPA qPCR перед отправкой на секвенирование.

Секвенирование РНК и анализ данных

библиотеки секвенирования РНК были секвенированы на приборе Novaseq 6000 в Лаборатории трансляционных исследований Медицинского колледжа Университета штата Флорида.Для каждого биологического повтора в этом эксперименте было получено приблизительно 40 миллионов односторонних чтений из 100 оснований, которые доступны в проекте архива чтений последовательностей NCBI, номер доступа PRJNA675860. Загрязняющие 3′-адаптерные последовательности были вырезаны из демультиплексированных необработанных считываний с использованием cutadapt версии 1. 16. Необработанные и обрезанные чтения были подвергнуты проверке качества с помощью fastqc. Обрезанные чтения были выровнены по сборке генома W22 «Zm-W22-REFERENCE-NRGENE-2.0» с использованием приспособления для сплайсинга hisat2.Вкратце, индексы Hisat2 были построены из известных экзонов и сайтов сплайсинга, извлеченных из аннотации генома W22 (Zm00004b) и эталонной сборки генома (Zm-W22-REFERENCE-NRGENE-2.0.fasta). Затем обрезанные чтения были выровнены с полученным индексом hisat2 с учетом сплайсинга с использованием следующих необязательных аргументов: –rna-strandness R, –dta-cufflinks, –summary-file. Предсказанные новые транскрипты были собраны и объединены в репликах и образцах с использованием stringtie2 в «консервативном» режиме. Таблицы покрытия транскриптов были подготовлены stringtie2 в формате «ballgown».Полученные таблицы покрытия были преобразованы в таблицы подсчета, подходящие для дифференциального анализа выражений с помощью DEseq2 в R с использованием пакета tximport. Анализ дифференциальной экспрессии проводили отдельно для каждой группы тканей, т. е. (мутант листа против WT и мутант метелки против WT). Вкратце, гены с менее чем 10 подсчетами во всех повторах были отброшены, и результаты DEseq2 были получены для обеих групп тканей, так что были представлены оценки log2 (кратность изменения) для соотношений (мутант/WT). Статистически значимый дифференциально выраженный (скорректированный p -значение <0.05) гены были впоследствии извлечены из каждой из полученных таблиц DEseq2 для дальнейшего анализа (дополнительная таблица 2).

Заявление о доступности данных

Исходные данные о последовательности, использованные в этом исследовании, находятся в открытом доступе в NCBI с регистрационным номером PRJNA675860.

Вклад авторов

Экспрессионные плазмиды, изготовленные HG и HB и используемые JM и KG для цитологического анализа. Данные микроскопии транзиентной экспрессии табака были получены, а изображения собраны JM с анализом изображений JM и KG.Анализ мутантов кукурузы, ПЦР-генотипирование, полное клонирование и выделение РНК проводили с помощью HG, фенотипирование кукурузы проводили с помощью AJ, AK, HG и HB. Анализ транскриптома и курирование SRA были выполнены ZT и HB. Эксперименты были разработаны, интерпретированы и описаны JM, HG, ZT, KG и HB. Все авторы прочитали и одобрили рукопись.

Финансирование

Эта работа была выполнена в рамках акции # CA16212 «INDEPTH», участники которой благодарны за плодотворные обсуждения.Эта работа была частично поддержана грантом HB от Национального научного фонда (NSF IOS 1444532).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы хотели бы поблагодарить отдел биовизуализации в Оксфорд Брукс за доступ к конфокальным микроскопам.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fpls.2021.645218/full#supplementary-material

Дополнительный рисунок 1 | Белки кукурузы NCh2 и NCh3 совместно локализуются со своим гомологом CRWN1 арабидопсиса. (A) Конфокальная визуализация живых клеток клеток, совместно экспрессирующих либо NCh2, либо NCh3 с CRWN1 Arabidopsis, показывает колокализацию. (B) График необработанных значений интенсивности FRAP в зависимости от времени для двух репрезентативных экспериментов FRAP: один для NCh2 (черный) и один для NCh3 (красный). (C) Нормализованные данные интенсивности нанесены на график для всех кривых NCh2 FRAP.Синие точки показывают отдельные точки данных, черные линии показывают соответствие кривой FRAP для каждого ядра, а красные линии показывают глобальные кривые FRAP, полученные из всех наборов данных (как показано на рисунке 1). (D) То же, что и панель C, за исключением NCh3. (E) Блок-диаграммы значений плато восстановления FRAP для NCh2 и NCh3. (F) Коробчатые диаграммы значений времени полураспада восстановления FRAP для NCh2 и NCh3. Для панелей E и F указаны отдельные точки данных из отдельных кривых восстановления FRAP (черные точки), среднее значение (красная линия), стандартные отклонения (синие линии) и статистическая значимость (звездочки). Студенты T — тест, выполненный в E и F , ∗∗ p ≤ 0,01, ∗∗ p 1 ≤ 0,0000. Средние значения и значения стандартного отклонения приведены в таблице под графиками. n ≥ 30 ядер в трех экспериментальных повторах.

Дополнительный рисунок 2 | Описание измерения соотношения флуоресценции субпериферических и целых ядер. Диаграмма, показывающая, как было определено измерение субпериферии по всем ядрам с использованием изображения J.Были созданы две области интереса (ROI), одна из которых охватывает все ядра, а одна — только субпериферическую ядерную флуоресценцию (желтые области интереса с заштрихованными границами). Затем значение субпериферической флуоресценции делили на значение флуоресценции всего ядра, чтобы получить соотношение. Если большая часть флуоресценции находится на периферии/ядерной оболочке, это приведет к низкому соотношению, и наоборот, если большая часть флуоресценции будет внутренней, это приведет к более высокому соотношению.

Дополнительный рисунок 3 | Множественное выравнивание последовательностей транскриптов. (A) Область 5′-UTR и небольшая часть CDS изображены на схеме, как показано на фиг. 5, и перевернуты (нижняя конфигурация), как выровнены при множественном выравнивании последовательностей. (B) Множественное выравнивание последовательностей отображает все чтения RNA-seq с полным совпадением с последовательностью запроса из 25 п.н. (желтый) с использованием grep файлов fastq. Все совпадения были преобразованы в последовательности FASTA для множественного выравнивания последовательностей. Эталонная последовательность генома показана вверху для сравнения.Идентификаторы последовательности начинаются с одиночных символов для ткани («L» для листа; «T» для кисточки), генотипа («1» для дикого типа, «2» для гомозиготного мутанта mkaku41) или биореплика («A», «B, ” или “C” для биорепликата 1, 2 или 3 соответственно), за которым следует уникальный идентификатор из имени чтения последовательности Illumina. Многоцепочечность указана относительно модели гена со всеми указанными антисмысловыми РНК (ANTISENSE, красный текст).

Дополнительная таблица 1 | Значения эффективности apFRET с внутренним контролем и множественными сравнениями всех обработок. (A) Все значения % эффективности apFRET для данных, представленных на рисунке 3C, включая значения внутреннего контроля. (B) Множественное сравнение Тьюки в одном направлении Набор данных Anova из всех представленных данных apFRET, включая данные, представленные на рисунке 3C.

Дополнительная таблица 2 | Дифференциально экспрессируемые гены между мутантными mkaku41 и растениями дикого типа для листьев и кистей кукурузы.

Дополнительная таблица 3 | Информация о плазмидах и идентификаторах Addgene.

Сноски

    Каталожные номера

    Алам С.Г., Чжан К., Прасад Н., Ли Ю., Чамала С., Кучибхотлс Л. и др. (2016). Комплекс LINC млекопитающих регулирует транскрипционные ответы генома на жесткость субстрата. науч. 6: 38063.

    Академия Google

    Бузид, Т., Ким, Э., Рил, Б.Д., Эсфахани, А.М., Розенбом, Дж., Ян, Р., и соавт. (2019). Комплекс LINC, механотрансдукция, функция и судьба мезенхимальных стволовых клеток. J. Biol. англ. 13:68.

    Академия Google

    Бринк, Р. А. (1956). Направленное и потенциально обратимое генетическое изменение, связанное с локусом R в кукурузе. Генетика 41, 872–889. doi: 10.1093/генетика/41.6.872

    Полнотекстовая перекрестная ссылка | Академия Google

    Чой, Дж., Стриклер, С.Р., и Ричардс, Э.Дж. (2019). Потеря ядерных белков CRWN вызывает гибель клеток и передачу сигналов защиты от салициловой кислоты. Завод физиол. 179, 1315–1329.doi: 10.1104/pp.18.01020

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Циска, М., и Морено Диас де ла Эспина, С. (2014). Интригующее растение ядерной пластинки. Фронт. Растениевод. 5:166.

    Академия Google

    Циска, М. , Хикида, Р., Масуда, К., и Морено Диас де ла Эспина, С. (2019). Эволюционная история и структура белков, составляющих ядерный матрикс, растительных аналогов ламинов. Дж. Экспл. Бот. 70, 2651–2664.дои: 10.1093/jxb/erz102

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Collings, D.A., Carter, C.N., Rink, J.C., Scott, A.C., Wyatt, S.E., Allen, N.S., et al. (2000). Ядра растений могут содержать обширные бороздки и инвагинации. Растительная клетка 12, 2425–2440. дои: 10.2307/3871239

    Полнотекстовая перекрестная ссылка | Академия Google

    Крисп М., Лю К., Ру К., Раттнер Дж. Б., Шанахан К., Берк Б. и соавт. (2006). Соединение ядра и цитоплазмы: роль комплекса LINC. J. Cell Biol. 172, 41–53. doi: 10.1083/jcb.200509124

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Де Магистрис, П., и Антонин, В. (2018). Динамическая природа ядерной оболочки. Курс. биол. 28, Р487–Р497.

    Академия Google

    Диттмер Т.А., Стейси Н.Дж., Сугимото-Ширасу К. и Ричардс Э.Дж. (2007). Гены малых ядер, влияющие на морфологию ядер у Arabidopsis thaliana . Растительная клетка 19, 2793–2803.doi: 10.1105/tpc.107.053231

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Эванс, Д. Э., и Грауманн, К. (2018). Линкер нуклеоскелета и цитоскелетного комплекса высших растений. Хобокен, Нью-Джерси: Джон Уайли.

    Академия Google

    Гербино, А., Прочино, Г., Свелто, М., и Кармосино, М. (2018). Роль мутаций гена ламина A/C в сигнальных дефектах, приводящих к кардиомиопатии. Фронт. Физиол. 9:1356.

    Академия Google

    Гото, К., Тамура К., Фукао Ю., Шимада Т. и Хара-Нисимура И. (2014). Новый белок ядерной оболочки KAKU4 модулирует морфологию ядра у Arabidopsis . Растительная клетка 26, 2143–2155. doi: 10.1105/tpc.113.122168

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гото, К. , Тамура, К., Нисимаки, С., Маруяма, Д., и Хара-Нишимура, И. (2020). Белок ядерной оболочки KAKU4 определяет порядок миграции вегетативного ядра и спермиев в пыльцевых трубках. Дж. Экспл. Бот. 71, 6273–6281. дои: 10.1093/jxb/eraa367

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Грауманн, К., и Эванс, Д.Э. (2017). «Ядерная оболочка — структура и взаимодействие белков», в Annual Plant Reviews Online , ed. Дж. А. Робертс (Чичестер: John Wiley & Sons, Ltd), 19–56. дои: 10.1002/9781118472507.ch3

    Полнотекстовая перекрестная ссылка | Академия Google

    Грауманн К., Рунионс Дж. и Эванс Д.Э. (2010). Характеристика белков SUN-домена в ядерной оболочке высших растений. Завод Ж. 61, 134–144. doi: 10.1111/j.1365-313x.2009.04038.x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гроб С., Шмид М. В. и Гроссниклаус У. (2014). Анализ Hi-C в арабидопсисе идентифицирует KNOT, структуру, имеющую сходство с локусом flamenco дрозофилы. Мол. Мобильный 55, 678–693. doi: 10.1016/j.molcel.2014.07.009

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гамбер, Х.К., Маккенна Дж. Ф., Эстрада А. Л., Яловец А. М., Картик А. С. и Грауманн К. (2019a). Идентификация и характеристика генов, кодирующих комплекс LINC ядерной оболочки у однодольных видов Zea mays . J. Cell Sci. 132:jcs221390. doi: 10.1242/jcs.221390

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Гамбер, Х.К., Маккенна, Дж.Ф., Толми, А.Ф., Яловец, А.М., Картик, А.С., и Грауманн, К. (2019b). MLKS2 представляет собой домен ARM и белок KASH, ассоциированный с F-актином, который участвует в развитии устьичного комплекса и мейотической сегрегации хромосом. Ядро 10, 144–166. дои: 10.1080/194.2019.1629795

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Го, Т., Мао, X., Чжан, Х., Чжан, Ю., Фу, М. и Сунь, З. (2017). Ламиноподобные белки негативно регулируют иммунитет растений посредством NAC с трансмембранным мотивом1-подобным9 и неэкспрессорным PR генам1 в Arabidopsis thaliana . Мол. Завод 10, 1334–1348. doi: 10.1016/j.molp.2017.09.008

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Хаган, И.и Янагида, М. (1995). Продукт гена образования веретена sadl+ ассоциирован с телом полюса веретена делящихся дрожжей и необходим для жизнеспособности. J. Cell Biol. 129, 1033–1047. doi: 10.1083/jcb.129.4.1033

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Хак, Ф., Ллойд, Д. Дж., Смоллвуд, Д. Т., Дент, К. Л., Шанахан, К. М., и Фрай, А. М. (2006). SUN1 взаимодействует с ядерной пластинкой a и цитоплазматическими неспринами, чтобы обеспечить физическую связь между ядерной пластинкой и цитоскелетом. Мол. Клеточная биол. 26, 3738–3751. doi: 10.1128/mcb.26.10.3738-3751.2006

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Hetzer, MW (2010). Ядерная оболочка. Гавань Колд-Спринг. Перспектива. биол. 2, а000539–а000539.

    Академия Google

    Хоу, Э. С., Мерфи, С. П., и Басс, Х. В. (2013). «Трехмерная флуоресцентная гибридизация акриламида in situ для растительных клеток», в Plant Meiosis: Methods and Protocols , под редакцией W.П. Павловски, М. Грелон и С. Армстронг (Тотова, Нью-Джерси: Humana Press), 53–66. дои: 10.1007/978-1-62703-333-6_6

    Полнотекстовая перекрестная ссылка | Академия Google

    Ху, Б., Ван, Н., Би, X., Карааслан, Э. С., Вебер, А. Л., и Чжу, В. (2019). Ламиноподобные белки растений опосредуют связывание хроматина на периферии ядра. Геном Биол. 20:87.

    Академия Google

    Айронс, С.Л., Эванс, Д.Е., и Брандиззи, Ф. (2003). Первые 238 аминокислот рецептора ламина В человека нацелены на ядерную оболочку растений. Дж. Экспл. Бот. 54, 943–950. doi: 10.1093/jxb/erg102

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Джанин А. , Бауэр Д., Ратти Ф., Миллат Г. и Меджат А. (2017). Ядерные оболочки: сложный LINC между ядерной оболочкой и патологией. Orphanet J. Rare Dis. 12:147.

    Академия Google

    Йоргенс, Д.М., Инман, Дж.Л., Войцик, М., Робертсон, К., Палсдоттир, Х., и Цай, В.Т. (2017). Глубокие ядерные инвагинации связаны с цитоскелетными филаментами – интегрированная биовизуализация эпителиальных клеток в 3D-культуре. J. Cell Sci. 130, 177–189. doi: 10.1242/jcs.1

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Карими, М., Инзе, Д., и Депикер, А. (2002). Векторы GatewayTM для опосредованной агробактериями трансформации растений. Trends Plant Sci. 7, 193–195. doi: 10.1016/s1360-1385(02)02251-3

    Полнотекстовая перекрестная ссылка | Академия Google

    Ламмердинг Дж., Шульце П.С., Такахаши Т., Козлов С., Салливан Т. и Камм Р.Д. (2004).Дефицит ламина A/C вызывает дефекты ядерной механики и механотрансдукции. Дж. Клин. Вкладывать деньги. 113, 370–378. DOI: 10.1172/jci200419670

    Полнотекстовая перекрестная ссылка | Академия Google

    Легартова С., Стиксова Л., Лаур О., Козубек С., Сеналова П. и Бартова Э. (2014). Ядерные структуры, окружающие инвагинации внутренних пластинок: морфология внутренних пластинок. Дж. Сотовый. Биохим. 115, 476–487. doi: 10.1002/jcb.24681

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Леппек, К., Дас Р. и Барна М. (2018). Функциональные структуры мРНК 5’UTR в регуляции трансляции у эукариот и как их найти. Нац. Преподобный Мол. Клеточная биол. 19, 158–174. doi: 10.1038/nrm.2017.103

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Лакстон, Г.Г., и Старр, Д.А. (2014). KASH с ядром: новые функциональные роли белков KASH на цитоплазматической поверхности ядра. Курс. мнение Клеточная биол. 28, 69–75. doi: 10.1016/j.ceb.2014.03.002

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Мэлоун, С. Дж., Фикссен, В.Д., Хорвиц, Х.Р., и Хан, М. (1999). UNC-84 локализуется в ядерной оболочке и необходим для миграции ядер и закрепления во время развития C. elegans. Дев. Камб. англ. 126, 3171–3181.

    Академия Google

    Мартиньер А., Лаваги И., Нагесваран Г., Рольфе Д. Дж., Манета-Пейре Л. и Луу Д. Т. (2012). Клеточная стенка сдерживает латеральную диффузию белков плазматической мембраны растений. Проц. Натл. акад. науч. США 109, 12805–12810. doi: 10.1073/pnas.1202040109

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Масуда К., Сюй З. Дж., Такахаши С., Оно М., Номура К. и Иноуэ М. (1997). Периферический каркас ядра клетки моркови содержит новый белок, который, как предполагается, имеет длинный альфа-спиральный домен. Экспл. Сотовый рез. 232, 173–181. doi: 10.1006/excr.1997.3531

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Маккарти, Д.Р. и Мили, Р. Б. (2009). «Ресурсы транспозонов для прямой и обратной генетики кукурузы», в Handbook of Maize , eds JL Bennetzen and S. Hake, (Нью-Йорк, штат Нью-Йорк: Springer), 561–584. дои: 10.1007/978-0-387-77863-1_28

    Полнотекстовая перекрестная ссылка | Академия Google

    Маккенна, Дж. Ф., Рольф, Д. Дж., Уэбб, С. Е. Д., Толми, А. Ф., Ботчвей, С. В., и Мартин-Фернандес, М. Л. (2019). Клеточная стенка регулирует динамику и размер нанодоменов плазматической мембраны у Arabidopsis . Проц. Натл. акад. науч. США 116, 12857–12862. doi: 10.1073/pnas.18116

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Мерфи, С.П., Симмонс, Ч.Р., и Басс, Х.В. (2010). Структура и экспрессия кукурузы ( Zea mays L.). Семейство генов белков домена SUN: свидетельство существования двух различных классов белков SUN в растениях. BMC Растение Биол. 10:269. дои: 10.1186/1471-2229-10-269

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ньюман-Гриффис, А.Х., дель Серро П., Шарпантье М. и Мейер И. (2019). Комплексы Medicago LINC действуют на морфологию ядер, движение ядер и симбиоз корневых клубеньков. Завод физиол. 179, 491–506. doi: 10.1104/стр.18.01111

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Павар В., Пуле А., Детурне Г., Тату К., Ванробейс Э. и Эванс Д. Э. (2016). Новое семейство белков, связанных с ядерной оболочкой растений. Дж. Экспл. Бот. 67, 5699–5710.

    Академия Google

    Ротбаллер, А., и Кутай, У. (2013). Разнообразные функциональные LINC от ядерной оболочки до цитоскелета и хроматина. Хромосома 122, 415–429. doi: 10.1007/s00412-013-0417-x

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Сакамото, Ю. (2020). Белки CRWN ядерной пластинки регулируют организацию хроматина, экспрессию генов и образование ядерных тел у растений. J. Завод Res. 133, 457–462.doi: 10.1007/s10265-020-01184-1

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Шермелле Л., Карлтон П. М., Хаазе С., Шао Л., Виното Л. и Кнер П. (2008). Субдифракционная многоцветная визуализация ядерной периферии с помощью трехмерной структурированной световой микроскопии. Наука 320, 1332–1336. doi: 10.1126/наука.1156947

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Спаркс, И. А., Рунионс, Дж., Кернс, А., и Хоуз, К.(2006). Быстрая временная экспрессия флуоресцентных белков слияния в растениях табака и получение стабильно трансформированных растений. Нац. протокол 1, 2019–2025 гг. doi: 10.1038/nprot.2006.286

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Старр, Д. А. (2019). Сеть белков ядерной оболочки и генераторов цитоскелетной силы опосредует движения ядер и внутри ядер на протяжении всего развития. Экспл. биол. Мед. 244, 1323–1332. дои: 10.1177/1535370219871965

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Старр, Д. А., и Фридольфссон, Х. Н. (2010). Взаимодействия между ядрами и цитоскелетом опосредованы мостиками SUN-KASH между ядерной оболочкой. год. Преподобный Cell Dev. биол. 26, 421–444. doi: 10.1146/annurev-cellbio-100109-104037

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Свифт Дж., Ивановская И.Л., Буксбойм А., Harada, T., Dingal, PC, and Pinter, J. (2013). Ядерный ламин-а масштабируется с жесткостью ткани и усиливает дифференцировку, направленную на матрикс. Наука 341, 1240104–1240104. doi: 10.1126/science.1240104

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Тамура, К., Гото, К., и Хара-Нишимура, И. (2015). Последние достижения в понимании белков ядерной оболочки растений, участвующих в ядерной морфологии. Дж. Экспл. Бот. 66, 1641–1647. дои: 10.1093/jxb/erv036

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Тамура, К., Ивабучи К., Фукао Ю., Кондо М., Окамото К. и Уэда Х. (2013). Myosin XI-i связывает ядерную мембрану с цитоскелетом, чтобы контролировать движение и форму ядер у Arabidopsis . Курс. биол. 23, 1776–1781. doi: 10.1016/j.cub.2013.07.035

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Ван, Х., Диттмер, Т. А., и Ричардс, Э. Дж. (2013). Arabidopsis скученные ядра (crwn). белки необходимы для контроля размера ядра и организации гетерохроматина. BMC Растение Биол. 13:200. дои: 10.1186/1471-2229-13-200

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чжан, X., Чжао, М., Маккарти, Д. Р., и Лиш, Д. (2020). Мобильные элементы используют разные стратегии интеграции по отношению к ландшафтам транскрипции в эукариотических геномах. Рез. нуклеиновых кислот. 48, 6685–6698. doi: 10.1093/nar/gkaa370

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чжао, В., Гуань, К., Фэн, Дж., Лян, Ю., Чжан, Н., и Цзо, Дж. (2016). Гены переполненных ядер Arabidopsis регулируют прорастание семян, модулируя деградацию белка ABI5: CRWN регулируют прорастание семян. Дж. Интегр. биол. растений 58, 669–678. doi: 10.1111/jipb.12448

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    Чжоу, X., Грауманн, К., Виртмюллер, Л., Джонс, Дж. Д., и Мейер, И. (2014). Идентификация уникальных белков ядерной оболочки, взаимодействующих с SUN, с разнообразными функциями у растений. J. Cell Biol. 205, 677–692. doi: 10.1083/jcb.201401138

    Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

    425_2008_781_Article-web 1..13

    %PDF-1.3 % 1 0 объект > эндообъект 9 0 объект > эндообъект 2 0 объект > поток

  1. 425_2008_781_Article-web 1..13
  2. конечный поток эндообъект 3 0 объект > эндообъект 4 0 объект > эндообъект 5 0 объект > эндообъект 6 0 объект > >> эндообъект 7 0 объект > эндообъект 8 0 объект > эндообъект 10 0 объект > эндообъект 11 0 объект > эндообъект 12 0 объект > эндообъект 13 0 объект > эндообъект 14 0 объект > эндообъект 15 0 объект > поток HW[ //?nZ 0{>fH&@?fN0mQ^O٫wY` &R>|Ssg$m5D U’df -kjӏ_0?w5ђ ^á[email protected]\Kw&Qg{aLcԹ,DKHtqgJ3��eU;Pm4-S%Sj#+U0w ; a&tNl\ JQ[}LaN છ tV»a^KxX[8;C],˒p[ vA’Ùf3’lK=’U5:xKL *»eDCP9)^Q]Jͮiu{:3p$&^»w8BٮXiM[rRZZ4S7Ơ`>P3

    Для размножения новое растение риса клонирует себя

    Поделись
    Артикул

    Вы можете поделиться этой статьей с атрибутом 4.0 Международная лицензия.

    Биологи растений открыли способ заставить культурные растения размножаться через семена в виде клонов.

    Открытие, к которому давно стремились селекционеры и генетики, может упростить размножение высокоурожайных, устойчивых к болезням или климатоустойчивых культур и сделать их доступными для фермеров всего мира.

    С 1920-х годов многие культуры выращивались из гибридных семян, полученных путем скрещивания двух сортов.Эти гибриды могут иметь превосходные качества в таких областях, как урожайность или устойчивость к вредителям. Но семена гибридных культур не дают растений с такими же качествами.

    Способность производить клон, точную копию растения из его семян станет крупным прорывом в мировом сельском хозяйстве. Вместо ежегодной закупки дорогих гибридных семян, что зачастую выходит за рамки средств фермеров в развивающихся странах, фермеры могли бы пересаживать семена своих собственных гибридных растений и из года в год получать выгоду от высоких урожаев.

    Имтияз Хандай и Венкатесан Сундаресан стоят с клонированными растениями риса в теплице в декабре 2018 года. (Источник: Карин Хиггинс/UC Davis)

    Около 400 видов диких растений могут давать жизнеспособные семена без оплодотворения. Этот процесс, называемый апомиксисом, по-видимому, много раз развивался у растений, но не у коммерческих сельскохозяйственных культур.

    «Это очень желанная цель, которая может изменить сельское хозяйство», — говорит Венкатесан Сундаресан, профессор биологии растений и наук о растениях Калифорнийского университета в Дэвисе.

    Ген «бэби-бума»

    Исследователи обнаружили, что ген риса BBM1, принадлежащий к семейству генов растений, называемых «бэби-бум» или BBM, экспрессируется в сперматозоидах, но не в яйцеклетках. После оплодотворения BBM1 экспрессируется в оплодотворенной клетке, но — по крайней мере первоначально — эта экспрессия происходит от мужского вклада в геном.

    Они полагали, что

    BBM1 включает способность оплодотворенной яйцеклетки образовывать эмбрион.

    Исследователи впервые применили редактирование генов, чтобы предотвратить мейоз растений, тип клеточного деления, в результате которого образуются четыре дочерние клетки, каждая из которых имеет половину числа хромосом родительской клетки.Вместо этого яйцеклетки формируются путем митоза, наследуя полный набор хромосом от матери.

    Затем они заставили эти яйцеклетки экспрессировать BBM1, чего они обычно не делают без оплодотворения.

    «Итак, у нас есть диплоидная яйцеклетка, способная производить эмбрион, который вырастает в клональное семя, — говорит Сундаресан.

    На данный момент эффективность процесса составляет около 30 процентов, но исследователи надеются, что смогут повысить эффективность за счет дополнительных исследований. По словам Сундаресана, этот подход должен работать на других зерновых культурах, которые имеют эквивалентные гены BBM1, а также на других сельскохозяйственных культурах.

    Основы биологии, основные результаты

    «Прелесть этой работы в том, что она затрагивает фундаментальные вопросы биологии растений о том, как оплодотворенная яйцеклетка начинает развиваться в новое растение», — говорит Энн Сильвестр, программный директор Национального научного фонда, поддержавшего исследование.

    «Это базовое понимание в сочетании с новыми технологиями бесполого размножения открывает двери для прорывов в растениеводстве, позволяя избежать потери полезных признаков, которая может произойти при половом размножении.

    Исследование опубликовано в журнале Nature .

    Другие авторы статьи из Калифорнийского университета в Дэвисе; Университет штата Айова; и INRA в Версале, Франция. Инновационный институт генома, совместное предприятие Калифорнийского университета в Беркли и Калифорнийского университета в Сан-Франциско, которое занимается применением редактирования генома для решения глобальных проблем, и Национальный научный фонд финансировали исследование.

    Источник: Калифорнийский университет в Дэвисе

    DOI оригинального исследования: 10.1038/с41586-018-0785-8

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.