Биозавивка мосса отзывы фото до и после: Биозавивка волос — «Биозавивка MOSSA — волшебство для редких прямых волос!+ОЧЕНЬ МНОГО ФОТО»

Содержание

Биозавивка волос - «Биозавивка MOSSA - волшебство для редких прямых волос!+ОЧЕНЬ МНОГО ФОТО»

Мой первый отзыв!Уж очень хочется поделиться с вами впечатлениями после биозавивки.

Без предыстории не обойтись, иначе вы не поймете,чем же мне подошла биозавивка))

Волосы мои очень тонкие, легкие, редкие((((ФОТО 1.,цвет волос родной,на солнышке золотистый блонд))).Для придания объема и видимости густоты всегда заплетала колосок на ночь и потом делала жуткий начес с большим кол-вом лака от корней до кончиков.(ФОТО 2-3). Ну, сами понимаете, волосы после такой "укладки" жесткие,но зато объем невероятный))Ну а что делать, лучше уж так, чем зализанной по черепу ходить.В парикмахерскую не ходила вообще! Кончики состригала себе всегда самостоятельно, а с тех пор как стала стричь их регулярно каждый месяц именно на растущую луну - волосы реально стали ОЧЕНЬ быстро расти!!Так, буквально за 4-5 месяцев, я с длины до плеч отрастила волосы чуть ниже лопаток, чего не могла добиться кучу лет!! И вот, устала я возиться с этими ежедневными(!) укладками и мытьем головы(волосы очень очень жирнели), и решила делать биозавивку.

К выбору мастера я подходила капитально, не хотелось попасть в руки непонятно кому..Обошла несколько салонов нашего города, мастера меня не устроили свои отношением - ничего толком объяснить не могут, только заверяют, что все будет хорошо. Спустя какое-то время блужданий по просторам инета по поводу биозавивки, нашла сайт Валентины Антоненко (супер-мастер,в Киеве). По форумам вычитала, что она рекомендует мастеров,которых сама же и обучала. Таким, образом, вышла я на своего мастера из Одессы(в 2х часах от моего города). На форуме видела ее работы завивки,покраски и пр. так что уже знала к кому иду. Созвонилась с ней, и поехала на завивку.

К мастеру я пришла с вот такими волосами (сразу после мытья, без объема, родненькие, так сказать - ну,какие есть, с отросшими корнями и остатками мелирования с лета 2011(ФОТО 4).

Итак, 2 часа до Одессы + 30 мин стрижка посеченных кончиков и подготовка волос к завивке + затем 3 часа накрутки на коклюшки мелкие, + 40 мин.

сидение с накруткой на голове (подтыканая ватой, и сверху в пакете) + еще минут 20 - это мытье волос (не раскручивая коклюшки) и нанесение какого-то закрепителя и сидение с ним...А еще я хотела кардинально покраситься..Из блондинки в темный. Итак, раскрутка, + еще и покраска волос, потом сушка с диффузором. На создание моего нового облика ушло реально чуть больше, чем пол дня..Уехала рано утром, а домой приехала вечером))

после 1 завивки - не то что я хотела получить у корней.

Первый раз сделала завивку 26 августа 2012. Но осталась не очень довольна. Завитки были отличные, мелкие, упругие, как я и хотела, но вот у самих корней как-то тухло было, того объема, которого я ожидала - не было.(ФОТО 5). И потому, я стала закалывать челку наверх и, по привычке, стала снова начесывать волосы у корней,но слегонца.А еще я делала хвостик на макушке на ночь,потому как волосы очень воняли первое время, и муж не мог нормально спать,когда они раскиданы по подушкам. Да еще и мыть их нельзя после завивки три дня..Теперь то я знаю, что делать что-то со своими волосами в первые дни после завивки нельзя - завиток еще не сформирован полностью, можно его "сломать"!!!Эти мои манипуляции конечно подпортили завитки (у корней, где я их мучала резинкой и начесом), и уже

10 декабря я поехала на вторую завивку. А рекомендуется делать завивку раз в пол года)

с начесом и спрей для укладки

Во второй раз все прошло так,как я и хотела сразу. Коклюшки мы выбрали самые мелкие и завивались еще дольше..Результат супер! Объем у корней невероятный, я иду, а кудри прям скачут в такт!))) Вонь тухлятиной, как положено, недели две держалась. С укладкой проблем особых нет. Крем или спрей на влажные волосы + диффузор. Естественным путем не сушу,вечно тороплюсь куда-то)). В последнее время не пользуюсь никакими средствами укладки вообще. Качество кудрей зависит от старания их создания))Если долго постараться,можно очень мелкие сделать(ФОТО 9),но я люблю их слегка расчесывать широким гребнем - ФОТО

без начеса и без укладочного средства

Подводя итог.

2 завивка, слегка расчесаны широким гребнем.

Нельзя завивать и красить волосы одновременно.не зря говорят, что после завивки должно пройти недели 3. Краска очень быстро смылась!И уже через месяц я в парикмахерской покрасилась в темный.

2 завивка - сделала мелкие кудри, чуть дольше возни с дифузором

Волосы хуже не стали. Состояние волос такое же, как и было до. Раньше секлись - и сейчас секутся так же.Только теперь они у меня очень мягкие и воздушные,потому что не порчу лаком.

после 2 завивки есть объем у корней,который я хотела

Длина стала короче. В связи с тем, что я стала ходить в парикмахерскую на стрижку (чтобы кучеряхи смотрелись объемнее), да еще и для кучерявых волос особая технология стрижки, т.е сама стричь теперь не могу - волосы теперь совсем короткие((( По плечи! Отращиваю теперь..Наверное начну снова стричь кончики на растущей луне.

2 завивка

Мытье волос раз в неделю, - это плюс! Сейчас волосы НЕ жирнеют, легкие, чистые, потому как я не пользуюсь лаками и прочим. Челка(которую закалываю) начинает жирнеть на 5-6 день, тогда и мою.

3 завивка - в парикмахерской, в процессе укладки

Пользуюсь бальзамом для волос при каждом мытье. Поначалу еще и специальными шампунями для кучерявых волос пользовалась, но особой разницы нет. Перешла на обычный пантин. + бальзам ревивор или ролланд (чередую).

3 завивка через 3 дня - дома, еще мокрые волосы,просто пожамканные руками

Еще до 2 завивки в ноябре, и после:весь январь - волосы очень сильно выпадали.Я не уверена, что это можно связать с биозавивкой. Т.к. сейчас вот все в норме, волосы уже не выпадают)) Может зимний холодный период как-то повлиял.

3 завивка 2 день - растрепанные после ветра волосы - кучеряшки немного разошлись

В марте будет уже три месяца после второй завивки, завитки немного разошлись, уже не такие мелкие, но разницы в их величине почти не видно).

Но с созданием кудрей уже сложнее, если в первые 1,5 месяца после завивки я полу-влажные волосы могла сформировать, то сейчас - только если они очень мокрые. На полу-влажных завиток большой получается, а мне нужны именно мелкие кучеряшки, для объема.

3 завивка (2 месяц) - волосы ничем не уложенные,высушенные естественным путем

В общем, я довольна. Повторную завивку планирую делать в июле или августе,как раз чуть больше полугода пройдет.

3 завивка (2 месяц) - волосы, высушенные ветром на море))

Рекомендую найти хорошего мастера!!!Который вам все по полочкам разложит, что да как, почему так, а не иначе, и на самом деле будет заботиться о ваших волосах, а не делать абы как, ради денег. Я не жалею, что приходится ехать в другой город и тратить время на дорогу, зато я уверена на все 100 в своем мастере!

3 завивка - обломыши отрастают (спустя почти месяц)

Стоимость этого удовольствия в первый раз была 800 грн (длина по лопатки,волосы с мелированием).

Повторная завивка (длина по плечи, затонированые волосы) 600 грн.

4 завивка в 1 же день вечером

На фото все прекрасно видно, какие волосы сами по себе, как я их убивала лаком с начесами, и какими они стали в итоге. Главное, чего я хотела добиться - это объем без начесов и лака, я это получила! Хочу выпрямляю, хочу просто расчесываю и получаю львиную гриву, хочу - просто диффузором мелкие кудри делаю...Возможно, для кого-то завивка на волосы с похожей структурой будет таким же спасением. Спасибо за внимание)Делайте выводы)))

4 завивка - аллергическая реакция после передержанного состава (после того как промыла водой кожу все прошло к следущему дню,но хзавитки постарадали - ведь их нельзя было мочить первые 2 дня)

 

4 завивка (спустя 3 месяца) Сквозь желтенькие пряди просвечивает мой отросший после 3 завивки РОДНОЙ пепельный цвет волос ... + волосы сухие из-за того,что на 4 завивке передержали состав

П,С,

Сделала 3 завивку, в этот раз на свой родной цвет волос (кроме 7 см кончиков).

После неудачного осветления блондераном я отращивала свой цвет, и вот 21.07.16 я наконец вернула себе долгожданные любимые кучеряшки!!! Поехала к тому же мастеру,только теперь уже цена не 800 грн, а намноооооооого больше))))

Прикрепляю еще несколько фото)

 

ДОПОЛНЯЮ

Девушки, рекомендовать мастера, о котором идет речь в посте, увы, уже не могу и не буду. После 3го посещения и завивки ситуация была плачевная. На фото видно,что есть завивки и да - они прекрасны. НО мастер обломала мне кучу волос из-за сильнейшего натяжения !!

+ изменился цвет волос, хотя я пришла на процедуры с отросшисм натуральным цветом кроме кончиков!!! Они выцвели!

Натянула прядки на коклюшки так, что кожа болела после процедуры еще день,на мои вопросы почему так больно в этот раз , ведь в предыдущие завивки она так не делала,ответила "Я всегда так делала,иначе не будет объема у корней" . И как итог - по линии роста волос и на макушке обломанные волосы, сначала это было едва ощутимое пальцами покалывание(как щетинка) в области лба по линии роста волос, а через месяц, когда подросли волоски, я поняла,что это обломанное все.

. + еще через какое-то время заметила что и по пробору и на макушке отрастают пучки обломанных волос.Сейчас они отрасли ,см 15 примерно,все торчком,а прядки довольно таки толстенькие поообламывались - следовательно я потеряла в объеме волос по пробору и по всей длине!

Делала завивку и у другого мастера (4 завивка январь 2017) , но и ее рекомендовать не могу - она подобрала не тот состав (у меня тонкие волосы ранее завитые, а она выбрала состав для крепких неокрашенных натуральных волос) + передержала состав (так что даже сын Валентины Антоненко Александр был в шоке - я ему писала за советом),когда у меня появились ранки (аллергическая реакция) к вечеру того же дня. Фото добавила..

Будьте внимательны,девушки,следите,сколько времени держат вам состав.

Я еще не теряю надежды найти в Одессе нормального мастера..

Девушки, повторюсь - не бойтесь, процедура биозавивки - отличная! Тут самое главное - к какому мастеру вы попадете.

От него зависеть будет результат!!

Химическая завивка волос, фото и отзывы

Химическая завивка волос — это инновационная технология, которая обеспечивает максимальную мягкость воздействия и первоклассный уход за волосами.

 

MOSSA– профессиональная биохимическая завивка  без    вреда для волос

Биозавивка MOSSA

Биозавивка – это революционный метод завивки, который позволяет сохранить блеск, цвет и упругость волос! Лосьены  биозавивки основаны на аминокислотах, которые заполняют поры волоса и не только прекрасно завивают, но и придают здоровый вид локонам!

 

Химическая завивка волос MOSSA не наносит никакого вреда волосам благодаря нейтральной ph технологии. Химическая завивка для волос MOSSA содержит экстракт бамбука ,удерживает влагу в волосах и восстанавливает их изнутри, придавая им блеск и силу.В формуле препарата MOSSA — использованы все новейшие технологии по уходу за волосами, что доказывает его эффективность и популярность во всем мире! 

 

Немного из истории завивок: Мосса – была разработана компанией ГРИНЛАЙТ. В этой завивке впервые был взят за основу цистеамин – производный белок волос, а перекись водорода в фиксаже была заменена на бромид, более щадящий компонент. После Моссы – другие компании тоже взялись за разработку биозавивок. Кстати их не так много. Около 10. Мосса единственная завивка с очень нейтральным запахом. Очень комфортна в выполнении. Я использовала в работе много завивок, но лучше Моссы – не встречала. Используя разные техники накрутки на Моссе можно добиваться разных результатов. Если не работали на Моссе – мой вам совет – попробуйте.

Интересно будет знать ваше мнение

Биозавивка Mossa является   щадящей БИО завивкой, благодаря двум  фактам.  Во-первых, препарат  оберегает ваши волосы натуральными компонентами, в частности, защитным действием натурального экстракта бамбука. Во-вторых, Mossa не содержит три самых агрессивных химических компонента, которые присутствуют в обычной химзавивке: тиогликолевой кислоты, аммиака и перекиси водорода. Такие особенности гарантируют надежный результат без повреждения структуры волоса.

 

Биозавивка держится на волосах от 3 до 6 месяцев, в зависимости от структуры и выбранного состава. Для каждого типа волос и особенностей их состояния нужен индивидуальный подход и правильно подобранный лосьен. Мастер сделает это профессионально, поэтому не рекомендуется выполнять эту завивку в домашних условиях.

 

Отныне никаких плоек, бигудей и других мучений! Ваши волосы могут быть одновременно вьющимися и здоровыми.

Как проходит процедура химической завивки волос

Химическая завивка волос (биозавивка) проходит в несколько этапов и включает воздействие эксклюзивного комплекса препаратов MOSSA с точным соблюдением всех технологий, а также специального бальзама MOSSA, который обеспечивает восстанавливающий уход и придает волосам бриллиантовый блеск после завивки.  Сначала используют предзавивочный шампунь, который  подготавливает волосы к воздействию активных составляющих  МОССА. Входящие в состав шампуня аминокислоты с небольшим молекулярным весом без труда проникают в кутикулу волос и увлажняют их изнутри. Три завивочных композиции биоологической завивки Мосса – №0, №1 и №2 – служат соответственно для труднозавиваемых, нормальных и ослабленных волос.

 

Составы МОССА состоят из нейтрализатора (он содержит жидкий цистеамин и создает стойкий и упругий завиток) и лосьона для завивки с цистеамином. На последнем этапе используют постзавивочный кондиционер с витаминами и аминокислотами, восстанавливающий нормальный рН волос, интенсивно увлажняющий их, смягчающий негативное воздействие щелочных компонентов биозавивки МОССА

 

ЭТАП 1

 

Моем голову специальным шампунем MOSSA

 

ЭТАП 2

 

Наносим на волосы защитное средство перед химзавивкой – эквалайзер,спрей для выравнивания структуры волос или обычный двухфазник

 

ЭТАП 3

 

Накрутка волос. Обратите внимание на накрутку на фото. Это не классический тип.На затылочной зоне коклюшки располагаются в шахматном порядке,по бокам вертикально,а на п-образной зоне классически. Этот схема расположения палочек наиболее часто встречается в химзавивках итальянских мастеров. Результат- наиболее естественный и натуральный вид локонов после завивки.

 

Этап 4

 

Капельно наносим состав для завивки. Не забываем,что мягкие и тонкие волосы очень трудно завиваются,поэтому мы не применяем к ним составы для обесцвеченных и мелированных волос. Эту ошибку допускают многие мастера, боясь повредить волосы,не получают пружинистый завиток. Чаще всего применяется состав для окрашенных волос.

 

ЭТАП 5

 

Заворачиваем голову в одноразовое полотенце на 15 минут.Таким образом,волосы получают дополнительное тепло. Время выдержки составов от 15 до 25 минут. Если через 15 минут вас не устраивает результат завитка – время можно продлить. Больше 25 минут завивки в составе не держат! После этого начинается – АНТИХИМИЯ. Процесс раскручивания волос!

 

ЭТАП 6

 

Смываем состав горячей водой и наносим фиксаж

 

ЭТАП 7

 

Не моем голову шампунем. Наносим бальзам MOSSA

 

И выполняем укладку при помощи укладочных средств

 

Существуют различные виды химической завивки волос, для которых подбираются разные составы.

Почему стоит делать химическую завивку в салоне

Такую сложную процедуру, как химическая завивка волос, должны выполнять только профессионалы. Мастера салона «ПРОФИ » Пятигорск, будучи экспертами многих брэндовl, уже более восьми лет используют био химической завивки волос, известную так же, как биозавивка волос.

 

Стилисты салона ПРОФИ прошли специальную подготовкуl, что дает им звание салона-эксперта.

 

После химической завивки волос вы можете прийти  на прикорневую химическую завивку. Эта процедура также требует соблюдения всех технологий завивки и зависит от опыта стилиста. Наши мастера —  используют свое ноу-хау для прикорневой завивки волос, что позволяет вам надолго сохранить свои шикарные кудри. 

Биозавивка волос – фото до и после: на средние волосы локоны

Биозавивка волос на средние волосы – это чудо-процедура, которая позволяет девушкам обзавестись шикарными локонами на долгое время. Фото до и после в нашей статье показывают, как она преображает волосы, делает их объемнее и привлекательнее. Если вы задумываетесь над тем, чтобы произвести биозавивку со своей шевелюрой, перед этим обязательно прочитайте нашу статью.

Биозавивка волос

 Загрузка ...

Что такое

Биозавивка является современной и щадящей альтернативой небезызвестной химии для волос. Она может похвастаться тем, что не имеет в составе агрессивных компонентов, от которых волосы приходят в ужас. А вот доля натуральных безвредных веществ равна 70%. Как вы можете заметить, что на химические компоненты остается 30%. Поэтому определенный вред для волос имеет место быть.

[youtube]https://youtu.be/TOz5BEAuo0I[/youtube]

Главная роль в биозавивке отводится цистеамину. Это синтетическая кислота, которая удаляет избыток серы и способствует улучшению структуры волос. Именно она виновница характерного резкого запаха локонов после процедуры. Но, вместе с тем цистеамин отвечает за ухоженное состояние шевелюры.

Стильные кудри — результат биозавивки

Главные достоинства

  • Основное преимущество биозавивки в том, что она способна даже жидкие тонкие волосы превратить в объемную соблазнительную шевелюру. Да-да, для нее совершенно не важна густота и структура ваших волос – биозавивка всегда на 5+ справляется со своей миссией.
  • Модные тенденции сезона 2019-2019 диктуют популярность естественных локонов. Но если природа не наградила вас кудряшками, это не повод проводить целый час один на один с плойкой каждое утро. Биозавивка подарит привлекательные локоны с натуральным эффектом.
  • Не будем лукавить и полностью исключать вред процедуры. Но все же, если сопоставить его и воздействие регулярных утюжков-плоек-укладок, то второе точно перевесит.

Биозавивка — фото до и после процедуры

[stextbox id=’info’]

Мы знаем, как часто может меняться ваше настроение. Сегодня вдруг захотелось головокружительных кудрей, а уже на следующий день душа требует идеальной гладкости волос? К счастью, биозавивка стойко вытерпит все женские капризы. Вы можете выпрямить волосы, а локоны вернуться сразу же после мытья головы.

[/stextbox]

Процедура биозавивки — дополнительный объем даже для тонких волос

Интересно: Химия на короткие волосы: фото до и после процедуры

  • Вы можете дольше спать утром, а потом просыпаться с готовой укладкой. Любимый точно будет в восторге и создаст прекрасную традицию «завтрак в постель».
  • Результат биозавивки может радовать вас не менее полугода. Главное, не забывать об уходе за волосами.
  • Процедура на лишает девушек возможности красить волосы. Поэтому, если вы решите подкрасить корни или сменить цвет шевелюры, биозавивка не будет препятствием для этого.

Результат биозавивки

Но есть и минусы

Как и любая бьюти-процедура биозавивка имеет не только преимущества, но и некоторые досадные недостатки.

  • Если ваши волосы отрицательно реагируют на любые воздействия химии, то и биозавивка не станет исключением. Пряди могут огорчить ломкостью, сечением и даже выпадением.
  • Технология наносит определенный вред структуре волос. Многие отзывы девушек отмечают, что после процедуры волосы пушатся и становятся пористыми.
  • Беременность, грудное вскармливание, заболевания кожи головы и воспалительные процессы в организме являются строгими противопоказаниями для проведения биозавивки.
  • В течение нескольких недель после процедуры придется мириться с запахом цистеамина. Шампуни, духи, розмариновые отвары имеют слабый эффект и практически бессильны. Должно просто пройти время для полного вымывания кислоты.
  • Если пренебречь уходом за волосами после процедуры, их состояние уже за месяц станет плачевным.

Правильный уход после процедуры — залог здоровья волос

Интересно: Химия на короткие волосы: фото до и после процедуры

Виды

Лидером по экономности является классическая биозавивка. Она не содержит в своем составе дополнительного питательного ухода – только компоненты для создания локонов.

Классическая биозавивка

  • Кудри ангела – вид завивки, который позволяет создать легкие и естественные локоны как на фото. В ее составе отмечены кератин, лецитин и протеины пшеницы. Парикмахеры часто используют именно этот вид для обесцвеченных или осветленных локонов.

Кудри ангела

  • Итальянская Мосса характеризуется наличием в составе аминокислот, которые отвечают за питание и восстановление волос после процедуры. Это гарантирует, что после биозавивки волосы должны остаться в хорошем состоянии.

Биозавивка mossa — фото до и после процедуры

  • Создание японской биозавивки продиктовано особенностью азиатских волос – они довольно жесткие, толстые и прямые. Если вы узнали в этом описании свою шевелюру, это самый подходящий для вас вид процедуры.

Японская биозавивка с крупными локонами

  • Протеиновая биозавивка иначе именуется шелковой. Она обеспечивает разглаживание волосяных чешуек и после этого локоны выглядят гладкими и шелковистыми.

Протеиновая завивка

  • Суть прикорневой завивки отображается в названии. Согласно этой технологии, волосы завивают лишь у корней, что создает потрясающий объем.

Прикорневая завивка волос

  • Спиральная завивка лучше всего подходит для создания упругих кудряшек. Такой эффект выглядит оригинально и подходит для девушек с выразительными чертами лица. Лучше всего спиральная биозавивка волос смотрится без челки.

Спиральная биозавивка

Интересно: Модные прически на средние волосы для выпускного 2019 пошагово (фото)

Особенности биозавивки на средние волосы

Абсолютно справедливо считается, что средняя длина волос лучше всего подходит для этой процедуры. Различные фото до и после показывают, что с помощью нее можно создать самые разные образы. Что вы желаете – четкие упругие локоны или небрежные натуральные кудри? Биозавивка на средней длине способна на любые эксперименты.

Биозавивка на средние волосы — фото до и после

Как отмечают стилисты, самыми актуальными на сегодняшний день являются довольно крупные локоны.

Биозавивка крупные локоны

[stextbox id=’info’]

В последнее время наметилась еще одна модная тенденция: девушки любят делать биозавивку волос на средние волосы с прямой челкой. При этом кудри создаются не от корней, а ближе к кончикам.

[/stextbox]

Кудри не от корней, а от середины волос

Получается интересный образ с акцентом на естественность. Также девушки экспериментируют с модным чередованием прямых и завитых прядок.

[youtube]https://youtu.be/cd5IPjRT1us[/youtube]

Размер кудряшек

Есть несколько простых правил, которые помогут вам определиться с желаемым размером локонов:

  • крупные локоны идеальны в создании объема;
  • спиральные локоны прекрасно подходят девушкам с продолговатым лицом и длиной волос ниже плеч;
  • афрозавивка уместна только с идеальной формой лица.
  • мягкие естественные волны – находка для девушек с круглым лицом;
  • для треугольного лица оптимальны вертикальные локоны различной формы.

Разного размера кудри

Интересно: Карвинг на короткие волосы: фото завитков до и после процедуры

Забота о волосах после процедуры

То, насколько красивой и ухоженной будет биозавивка, зависит от того, как ответственно вы подойдете к уходу за волосами.

Правильный уход — залог здоровья волос после биозавивки

[stextbox id=’info’]

Обратите внимание! Если вообще пренебречь этим этапом, то ваша шевелюра рискует довольно быстро превратиться в «мочалку».

[/stextbox]

Биозавивка — фото до и после

  • После посещения салона отложите мытье головы и воздействие фена на 2-3 дня.
  • Теперь лучшей расческой для волос будет деревянный гребень с редкими зубчиками.
  • Внимательно изучите состав шампуня. Если вы найдете в перечне ингредиентов силикон, то этот продукт вам подходит.
  • После процедуры лучше свести к минимуму использование фена. Если же это невозможно, то устанавливайте низкую температуру воздуха.
  • Подружитесь с питательными и восстанавливающими масками. Шевелюра будет вам благодарна за домашний спа-салон с ухаживающими процедурами хотя бы раз в неделю.
  • Различные химические воздействия (например, окрашивание или мелирование) лучше отложить на 2 недели после завивки.

Биозавивка — увеличивает объем, избавляет от ежедневной укладки

Биозавивка волос на средние волосы позволит вам создать мелкие или крупные локоны, которые будут радовать вас долгие месяцы. Не забывайте заботиться о своей шевелюре, и тогда результат процедуры будет действительно великолепным. Желаем вам удачи в бьюти-экспериментах!

Биозавивка волос МОССА: отзыв, фото, цена

Итак, я снова стала кучерявой. Только теперь мои волосы не сухие и жесткие, как от обычной химии, а такие же, какими были, только – вьющиеся. Процедура, с помощью которой мне удалось этого достичь – биозавивка волос, по технике исполнения очень похожая на химическую завивку, только другой состав, а следовательно, другой механизм действия.

Препарат для биозавивки волос «МОССА» (MOSSA) – щадящий перманент, который не содержит аммиака и перекиси водорода. Даже его запах сильно отличается от запаха привычных нам препаратов, таких как Локон или Лонда.

Как делают биозавивку волос. Процесс биозавивки во многом похож на обычную химическую завивку:  те же коклюшки, те же бумажки, те же способы накрутки: вертикальный, горизонтальный, крупней, мельче и т.д.

  1. Биозавивка делается на чистые влажные волосы.
  2. Волосы делятся проборами на несколько частей и накручиваются на коклюшки так же, как и при обычной химической завивке. В моем случае была сделана вертикальная завивка.
  3. Первый состав наносится на накрученные волосы, затем на голову надевается утепляющий колпак — полиэтиленовая шапочка и полотенце. Время воздействия препарата – от 25 минут. Мастер периодически раскручивает одну из прядок, чтобы проверить, как подействовал состав.
  4. Когда состав подействовал (образовался достаточно упругий завиток), его смывают теплой водой и наносят следующий – нейтрализатор, который воздействует на волосы в течение 5 минут.
  5. Затем второй состав смывается, коклюшки снимаются, и следует тщательное мытье головы, дабы удалить остатки средств.
  6. Расчесывать волосы не обязательно, достаточно просто высушить.

После процедуры мне немного подстригли кончики (давно пора было это сделать).

Эффект биозавивки. Раньше мне несколько раз делали химию разными средствами, и каждый раз портили волосы. Приходилось их стричь, лечить и даже делать кератиновое выпрямление. Теперь же, после биозавивки, мои кудри остались живыми, мягкими, сохранили блеск.

Связь со мной в инстаграме - @okosmeo.
Отвечу на все вопросы в комментах, подписывайтесь!

Конечно, завитки не такие выраженные, как после химии – это скорее волны, чем спирали, но зато качество сохранилось. Эффект биозавивки рассчитан примерно на полгода и постепенно сходит на «нет», возвращая локонам их первоначальный вид.

На фото ниже — окончательный результат, волосы после мытья. Даже мокрые, они сохраняют небольшие завитки. В качестве уходовых средств я применяла только аргановое масло. Сушила без фена, не расчесывала. Средств для укладки также не применяла.

Порадовало: волосы не «сожглись», как после обычной химии, хотя сами по себе мои кончики здоровыми не назовешь. Ухаживать за волосами после биозавивки стало намного легче: расчесывать их следует только перед мытьем, средств для укладки биозавивка не требует, да и голову мыть можно реже, так как жирные корни хоть немного подсушились. Визуально волосы стали объемнее.

Огорчило: эффект скорее похож на локоны, чем на кудри, он мало выражен, концы более прямые, чем корни, и их все равно придется накручивать.

Как ухаживать.

  1. После процедуры биозавивки волосы нельзя мыть и мочить в течение 48 часов.
  2. Окрашивать лучше не ранее, чем через неделю после процедуры.
  3. Желательно приобрести специальные средства по уходу за локонами: шампунь, спреи, увлажняющие маски и пр. У меня это шампунь L’Oreal
  4. Расчесываться следует только перед мытьем, иначе рискуете вместо вьющихся локонов заполучить прическу-«одуванчик».
  5. Для поддержания эффекта рекомендуется раз в полгода повторять процедуру биозавивки.

Цена биозавивки зависит от длины и густоты волос, а также от салона, в котором вам ее делают. Мне она обошлась в 5300р.

Немного о печальном (добавлено спустя 2 года): биозавивка хотя и щадящий способ по сравнению с обычной химией, всё равно после нескольких процедур волосы портит. Многократное наслоение одной завивки на другую дает сухость, ломкость, сеченые кончики и общий вид «мочалки». И если первая завивка выглядела очень даже прилично, то последняя (4 завивки в течение 2 лет 1 раз в полгода) вот так:

Поэтому мне пришлось бросить делать биозавивку, подождать, пока она немного отрастет, чтобы было достаточное расстояние от корней, и восстановить волосы кератином.

Биозавивка волос mossa (30 фото)

Мечтой каждой женщины являются ниспадающие превосходные локоны. Такой эффект можно получить с биозавивкой Мосса. При проведении такой процедуры не используются составы, вредящие волосам, а поэтому о пагубном воздействии можно забыть.

 

Биозавивка волос mossa, фото из салона красоты

Биозавивка Мосса на рыжих волосах, фото “до” и “после” процедуры

Химическая завивка на длинных крашеных волосах

Мелкие кудри, созданные с помощью биозавивки

Создание биозавивки Мосса на светлых локонах

Биозавивка волос Мосса, фото для съемки

Биозавивка Мосса на очень длинных тонких волосах

Биозавивка спустя неделю после проведения процедуры

Химическая завивка в салоне красоты, фото “до” и “после”

Завивка волос Мосса по итальянской технологии

Биозавивка Мосса на пышных от природы локонах

 

Химическая завивка, созданная в салоне красоты аккуратно

Завивка длинных волос с окрашиванием в белый тон

Сильная завивка волос до появления эффекта “лохматости”

Биозавивка Мосса на прямых светлых волосах

Биохимическая завивка на очень коротких волосах

Мелкие кудряшки с помощью биозавивки Мосса на длинных волосах

Мосса на волосах до плеч

 

Биозавивка Мосса на афроамериканке

Итальянская технология химической завивки для огненно-рыжих волос

Биозавивка на локонах средней длины

 

Оригинальная прическа для фотосессии на волосах, подверженных биозавивке

Биозавивка волос Мосса на коротких рыжих локонах

Омбре с химической завивкой на волосах немного ниже плеч

 

Мосса на длинных тонких локонах

Биозавивка натуральных волос

Биозавивка Мосса на короткие мелированные волосы

Завивка волос по типу “итальянской”

Мне нравится1Не нравится

Ответы на самые распространенные вопросы по биозавивке волос

Как выбрать бренд для биозавивки?

Совместно с мастером. На нашем сайте мы пишем о лучших марках, выпускающих средства для завивки, но это скорее информационная составляющая, нежели каталог продукции. На обязательной предварительной консультации специалист посоветует вам наилучший для ваших волос и здоровья вариант. 

Сколько держится биозавивка на волосах?

В описании брендов биозавивки обычно указывается срок до 9 месяцев, но данный показатель очень индивидуален: завивка может распрямиться через неделю, если сделать ее без учета противопоказаний, или сохраняться в виде естественных волн до одного года. Помните, что однажды измененная структура волоса без дополнительных манипуляций (например, кератинового выпрямления волос) не сможет полностью вернуться к прежнему виду самостоятельно. Это не значит, что ваши кудри будут жить до момента кардинальной стрижки, внешне они могут стать прямыми. 

Сколько длится сеанс биозавивки волос?

Все зависит от показателей шевелюры: длины, толщины и жесткости волоса, густоты и здоровья. Локальная завивка займет минимум 30 минут, но чаще всего процедура длится от двух до трех с половиной часов.

Что нельзя делать перед биозавивкой волос?

•Обесцвечивать, подвергать различным деформациям, содержать в стрессовых условиях шевелюру. На нездоровую прическу профессионал не станет делать биозавивку ни при каком раскладе.

•Красить волосы – необходим значительный промежуток между этими процедурами, иначе вы столкнетесь с искажением оттенка. 

•Использовать природные пигменты: хну и басму. К сожалению, они не совместимы с манипуляциями по созданию долгоиграющих завитков.

•Выпрямлять локоны кератином – он не позволит составу биозавивки изменить структуру волос.

•Лечить и ухаживать за прической препаратами с содержанием силикона. Кудряшки не «возьмутся».

•Скрывать от мастера состояние своего здоровья, историю преображения своих волос и другие факты, выявляющие противопоказания к завивке. 

Как подготовиться к биозавивке?

•Прежде всего, пройти очную консультацию и достигнуть с мастером взаимного понимания и доверия. 

•Исключить использование средств, влияющих на проницаемость волоса, а также, при необходимости, пройти рекомендуемые процедуры по оздоровлению локонов. 

•Настроиться на успешный результат и в хорошем расположении духа прибыть в салон красоты – от вашего настроя зависит 50% успеха любой салонной процедуры.

Почему мастер может отложить биозавивку на некоторое время?

Подробно мы описали все причины в материале «Противопоказания к биозавивке». Без паники, профессионал принимает подобное решение во благо вам и вашему здоровью.

Биозавивка и покраска волос – можно ли делать их в один день?

Не советуем. Даже если состав завивки позволяет такое совмещение в своей аннотации. Лучшим решением станет окрашивание кудряшек через две-три недели после процедуры. Тогда и цвет, и упругий завиток будут именно такими, как вы хотите.

Прикорневой объем при завивке – как его добиться?

•Прикорневая завивка. Она затрагивает только корни, создавая необходимый объем и пышность прически.

•Следование советам профессионалов. Создание многоуровневой стрижки перед завивкой и применение градуировки, помогающих преодолеть естественную гравитацию и исключить распрямление завитков на длинных и средних волосах.

Почему шевелюры, окрашенные хной или басмой, не стоит завивать?

Ответ можно увидеть только под микроскопом: натуральный пигмент настолько сильно забивает волос, что для компонентов биозавивки просто не остается свободного места. Хна и басма овладевают структурой локонов надолго, поэтому долговременные завитки рискуют «не взяться» даже через полгода после такой покраски.

Обязательно ли подрезать кончики волос перед биозавивкой?

Мы очень рекомендуем послушать своего мастера и провести эту обновляющую прическу процедуру перед завиванием локонов. 

Во-первых, вы оздоровите свои волосы, убрав самые слабые их части, а прибегнув к стрижке горячими ножницами, вы существенно сократите потерю жизненно важных компонентов через свежий срез.

Во-вторых, завивка отлично смотрится на сложных стрижках, проведенных с применением таких специальных техник как градуировка. Ваш новый образ только выиграет от такого незначительного вмешательства.

Какая биозавивка подойдет для обесцвеченных волос?

Самая щадящая, с лечебными компонентами и восстанавливающим действием. Такими качествами в той или иной мере могут похвастаться бренды LANZA, MOSSA, CHI IONIC, Davines, Niagara и ISO Texture.

Вернет ли биозавивка здоровье и блеск волосам?

Как мы уже упоминали выше, здоровой шевелюре отлично проведенная биозавивка добавит блеска и гладкости, напитает прическу и устранит мелкие, невидимые глазу недостатки. Однако не стоит ждать волшебства, если ваши волосы находятся в плачевном состоянии. Такую шевелюру нужно лечить, а не подвергать новым трансформациям.

Будут ли выпадать волосы после биозавивки?

Обильное выпадение волос, свойственное пережженной химке, при профессиональном проведении завивки с применением биосредств, исключается. Однако если у вас и до процедуры была такая проблема, то сеанс создания завитков ее не устранит, а в некоторых случаях может несколько усилить. Расскажите о своих проблемах, опасениях и ожиданиях своему мастеру на консультации, воочию ему будет проще предсказать, ждет ли вас такая неприятность.

Как ухаживать и питать волосы после биозавивки?

Уход за шевелюрой подбирается индивидуально, и давать усредненные советы мы не станем. Это сфера деятельности специалиста, работающего с вашей шевелюрой. Вкратце, исходя из богатого опыта, можем отметить эффективность салонных процедур и профессиональной косметики. А вот бабушкины рецепты и маски из супермаркетов – это настоящая лотерея для завитых локонов.

Как часто можно делать биозавивку?

Мы работаем с лучшими брендами, дающими долговременный эффект, поэтому периодичность завивки два раза в год при должном уходе можно назвать оптимальной и безопасной. Повторная завивка не исключает предварительную консультацию, поэтому каждый раз мастер определяет состояние волос и дает советы относительно оптимального состава и готовности шевелюры к новому преображению.

Какая биозавивка возьмется на толстых и тяжелых волосах?

Для такого типа локонов разработаны специальные составы: Alkaline wave, Exothermic wave, также подойдут универсальные Twisty, Niagara и ISO texture.

Какую биозавивку посоветуете сделать во время лактации?

Настоятельно рекомендуем отложить эту идею до момента, когда кормление грудью будет прекращено. 

Во-первых, ваш гормональный фон еще не пришел в норму, и из-за этого завитки могут быстро раскрутиться. Ни о каких шести-девяти месяцах речь точно не пойдет, вероятность раскручивания кудряшек через пару недель после процедуры весьма высока.

Во-вторых, все, что вы потребляете внутрь и наносите на себя снаружи, может оказывать влияние на вашего малыша, проникая в кровоток и молоко. Зачем вам такой риск? 

Карвинг – это биозавивка?

И да, и нет. Карвинг держится меньшее время, завитки при нем - волнообразные, а не тугие, как при завивке. Это просто долговременная укладка, облегчающая жизнь своей обладательнице. Настоящие кудри держатся в три раза дольше, стоят, соответственно, дороже. Однако учитывая сегодняшнее разнообразие техник и подходов, иногда сложно провести черту между карвингом и волнообразной биозавивкой.

Сколько стоит биозавивка?

Стоимость данной процедуры складывается из нескольких составляющих:

•Цена брендового состава

•Качество шевелюры: длина и густота

•Выбранная техника – форма и локация завитушек

•Квалификация мастера

Соответственно, цена имеет очень широкий  диапазон. Одно можно сказать уверенно: биозавивка не может стоить как химка, не покупайтесь на рекламу, обещающую вам качественную услугу по низкой стоимости, и доверяйте свои волосы только профессионалам с хорошими отзывами.

Как укладывать волосы после биозавивки?

Очень просто! Самый простой вариант – влажные локоны аккуратно разделить при помощи пальцев, нанести стайлинговое средство и высушить естественным образом. Для эффекта мокрых волос необходимо использовать соответствующие гели и муссы.

Можно накручивать локоны на самые разные бигуди за исключением термических. Тогда вы сможете менять образ ежедневно. 

Можно делать укладку при помощи диффузора или посещать салон красоты. В любом случае стайлинг завитых волос – это быстро и просто.

Можно ли временно выпрямлять завитые волосы утюжком или феном с расческой?

Термическое воздействие на волосы сократит жизнь кудряшек и может повредить прическу. За одноразовым выпрямлением рекомендуем идти в салон красоты, где с помощью профессиональной техники и средств вам смогут создать желанный образ.

Как избавиться от неудачной завивки?

Процедура кератинового выпрямления волос станет лучшим выбором в данной ситуации. 

Какой шампунь и средства для укладки подобрать после биозавивки?

Рекомендуем не экономить на этом пункте и приобрести качественные профессиональные средства для кудрявых и завитых волос. Совет мастера будет бесценным в данном вопросе.

Как будет «сходить» биозавивка?

Кудряшки будут отрастать и выпрямляться постепенно, создавая очень естественный образ на любом этапе. Никаких границ, заломов и других неприятных последствий химки вы не увидите на своей шевелюре после биозавивки.

Есть ли запах после биозавивки?

Некоторый аромат, который сложно назвать неприятным, присутствует во время процедуры. По окончании сеанса волосы очищаются от действующего вещества специальным средством, устраняющим этот запах. 

С какими процедурами можно совмещать биозавивку?

Если речь идет об уходе за волосами, то это:

•Ламинирование

•Кератиновая инфузия

•СПА-программы

Если вы имеете в виду, чем занять себя во время биозавивки, то предварительная договоренность позволит вам привести в порядок ваши руки и ноги, получить сеанс массажа, в котором не требуется горизонтальное положение, и пройти косметологический сеанс преображения.

 

 

 

Биозавивка волос цена, выполняет стилист по волосам, качественно, недорого, фото до и после на средние волосы, крупные локоны, отзывы в Москве в салоне красоты Сахар

Техника длительной укладки применима для любой длины прядей. В зависимости от размера волн биозавивка бывает следующих видов:

Стоимость биозавивки волос, а также продолжительность ее результата напрямую зависят от компонентов фиксирующих средств и технологии.

  • Итальянская. При помощи экстракта бамбука создаются мелкие кудряшки, которые держатся до 4 месяцев.
  • Японская. Легко справляется с толстыми и густыми локонами. Составы содержат аминокислоты, коллаген, белковые коктейли. Эффект сохраняется от 3 до 5 месяцев, после чего требуется коррекция.
  • «Шелковая волна». Экстракт шелка, содержащийся в составе комплекса, делает биозавивку максимально бережной. Подходит для поврежденных локонов, коррекции «химии». Результат держится 2 – 3 месяца.

Биозавивка волос в салоне красоты производится в несколько этапов: помывка головы специальным шампунем; просушивание при помощи полотенца; накручивание на бигуди; покрытие профессиональным составом; выдерживание; смывание; нанесение фиксатора и восстанавливающего препарата; причесывание. Длится сеанс 1,5 – 2 часа.

Ухоженная естественность – цель, достичь которую способен только мастер высочайшего класса!

Преимущества

  • Роскошный внешний вид.
  • Продолжительный эффект.
  • Возможность выбирать размер кудрей.
  • Безвредные составы применяемых средств.
  • Дополнительное питание.
  • Простой уход и укладка.

Стрижка до или после биозавивки

Леди, хоть раз в жизни проходившие процедуру химической завивки, наверняка вспомнят, что придание прическе формы происходило после процедуры накручивания.

Это было обусловлено повреждающим эффектом перманента на кончики волос. Такой подход также был целесообразен потому, что завиток получался действительно крутым и крепким и вытягивание при стрижке не приводило к его деформации.

Новые технологии диктуют свои правила: сегодня порядок действий противоположен ранее установленному – стрижка производится до сеанса биозавивки. И для этого есть минимум три причины:

  • качество прически и точность формы в таком случае будут лучше;
  • новые завитки нуждаются в некоторой заботе и покое – не стоит их беспокоить в первые дни после процедуры;
  • бережный биосостав не только не портит волосы, но и укрепляет их, поэтому кончики волос остаются целыми, особенно после стрижки горячими ножницами.

Почему стоит записаться к нам

Сделать биозавивку волос в Москве предлагает салон «Сахар». Нас выбирают по ряду причин:

  • Дипломированные мастера высокого уровня.
  • Комфортная и доброжелательная обстановка.
  • Гарантированный результат.
  • Скидки и акции для каждого клиента.

Записывайтесь к нам через обратную форму на сайте или звоните по указанному телефону. Мы рады вам помочь!

Свидетельств и обзоров - BioWaveGO

"Привет,

Спасибо за письмо и за разработку чуда обезболивающего Biowave HOME.

был первым ветераном моего штата Вирджиния, получившим устройство Biowave HOME. В течение многих лет я использовал устройства TENS от боли в пояснице, чтобы расслабить мышцы, которые напрягаются и вызывают невыносимую боль. Моя жизнь была полна боли с 1973 года, когда я повредил спину в автокатастрофе. Я использовал хиропрактики, обезболивающие, физиотерапию, упражнения на растяжку, ЧЭНС, иглоукалывание, точечный массаж, инъекции в триггерные точки и т. Д.за большие деньги, время и при низком качестве жизни.

Когда мой брат-ветеран из штата Теннеси рассказал мне о своем друге-ветеране, который с отличными результатами использовал устройство Biowave HOME, я заинтересовался. Мой брат сказал мне, что у него есть прокладки, как у устройства TENS, но оно работает глубже в мышцах и тканях. Я долгое время работал электронным техником и радиолюбителем, поэтому я сказал своему брату, что устройство Biowave HOME должно работать на более высокой частоте и, вероятно, с более высоким уровнем мощности.Я подтвердил это на вашем веб-сайте, позвонил и много поговорил с опытным специалистом службы поддержки клиентов. Я забыл его имя, но он мне очень помог. Я получил свое устройство около 9 месяцев назад и получил действительно отличные результаты, и со временем экспериментировал с различными техниками.

Я обнаружил, что могу добиться лучших результатов и более продолжительных результатов, включив упражнения на растяжку во время 30-минутной процедуры, концентрируясь на самых напряженных участках моих мышц. Затем во время последней части лечения я концентрируюсь на оставшихся болезненных участках.Делая это, я обычно могу получить до трех дней качественного обезболивания и большей гибкости за один сеанс. Когда после лечения у меня остается более одной области сильной боли, я нахожу и точечно указываю на область боли и провожу 30-минутную процедуру, как описано выше, чтобы исправить эту область. Я продолжаю проверять, нет ли болезненных участков или нет, и концентрируюсь на них, как описано. Я успешно вылечил до трех таких областей с помощью до трех дней безболезненного обезболивания, что позволило мне двигаться, ходить и спать, что значительно улучшило качество моей жизни.Если я планирую сгибаться, выполнять легкий подъем или работу, я использую тяжелый пояс Nike для тяжелой атлетики, плотно натянутый на поясницу.

Дом с биозавивкой изменил мою жизнь стремительно. Я всегда буду глубоко признателен вам и вашей замечательной команде поддержки. И это сделано в США. Это очень много значит для 73-летнего ветерана-патриота ВМС США ».

Безопасность | Стеклянная дверь

Мы получаем подозрительную активность от вас или кого-то, кто пользуется вашей интернет-сетью.Подождите, пока мы подтвердим, что вы настоящий человек. Ваш контент появится в ближайшее время. Если вы продолжаете видеть это сообщение, напишите нам чтобы сообщить нам, что у вас возникли проблемы.

Nous aider à garder Glassdoor sécurisée

Nous avons reçu des activités suspectes venant de quelqu’un utilisant votre réseau internet. Подвеска Veuillez Patient que nous vérifions que vous êtes une vraie personne. Вотре содержание apparaîtra bientôt. Si vous continuez à voir ce message, veuillez envoyer un электронная почта à pour nous informer du désagrément.

Unterstützen Sie uns beim Schutz von Glassdoor

Wir haben einige verdächtige Aktivitäten von Ihnen oder von jemandem, der in ihrem Интернет-Netzwerk angemeldet ist, festgestellt. Bitte warten Sie, während wir überprüfen, ob Sie ein Mensch und kein Bot sind. Ihr Inhalt wird в Kürze angezeigt. Wenn Sie weiterhin diese Meldung erhalten, informieren Sie uns darüber bitte по электронной почте: .

We hebben verdachte activiteiten waargenomen op Glassdoor van iemand of iemand die uw internet netwerk deelt.Een momentje geduld totdat, мы выяснили, что u daadwerkelijk een persoon bent. Uw bijdrage zal spoedig te zien zijn. Als u deze melding blijft zien, электронная почта: om ons te laten weten dat uw проблема zich nog steeds voordoet.

Hemos estado detectando actividad sospechosa tuya o de alguien con quien compare tu red de Internet. Эспера mientras verificamos que eres una persona real. Tu contenido se mostrará en breve. Si Continúas recibiendo este mensaje, envía un correo electrónico a para informarnos de que tienes problemas.

Hemos estado percibiendo actividad sospechosa de ti o de alguien con quien compare tu red de Internet. Эспера mientras verificamos que eres una persona real. Tu contenido se mostrará en breve. Si Continúas recibiendo este mensaje, envía un correo electrónico a para hacernos saber que estás teniendo problemas.

Temos Recebido algumas atividades suspeitas de voiceê ou de alguém que esteja usando a mesma rede. Aguarde enquanto confirmamos que Você é Uma Pessoa de Verdade.Сеу контексто апаресера эм бреве. Caso продолжить Recebendo esta mensagem, envie um email para пункт нет informar sobre o проблема.

Abbiamo notato alcune attività sospette da parte tua o di una persona che condivide la tua rete Internet. Attendi mentre verifichiamo Che sei una persona reale. Il tuo contenuto verrà visualizzato a breve. Secontini visualizzare questo messaggio, invia un'e-mail all'indirizzo per informarci del проблема.

Пожалуйста, включите куки и перезагрузите страницу.

Это автоматический процесс. Ваш браузер в ближайшее время перенаправит вас на запрошенный контент.

Подождите до 5 секунд…

Перенаправление…

Код объявления: CF-102 / 67154a5988781667.

животных моделей поведенческого анализа

Об этой книге

Введение

Несмотря на сложность сравнения клинических испытаний на людях с испытаниями на моделях животных, по-прежнему существует большая ценность в применении трансляционных подходов, поскольку могут быть разработаны тесты и стратегии лечения для улучшения функции мозга у людей, страдающих неврологическими заболеваниями, и знания, полученные от людей с поведенческими нарушениями. исследования могут быть использованы для дальнейшего улучшения моделей поведенческого анализа на животных.В моделях поведенческого анализа на животных эксперты-нейробиологи сосредотачиваются на подходах к переводу и сравнению поведенческих тестов, используемых на животных, с тестами, используемыми на людях, не только для улучшения нашего понимания функции мозга у разных видов, но и для обеспечения объективных показателей эффективности и устранения разрыва между поведенческими тестами. изменения у людей с когнитивными расстройствами и соответствующие животные модели этих состояний. Написанные в формате серии Neuromethods, главы содержат авторитетные обзоры многих широко используемых сегодня подходов.Провокационные и ультрасовременные модели поведенческого анализа на животных призваны помочь исследователям в дальнейшей разработке этих жизненно важных методов, чтобы продвинуть исследования как в клинике, так и в лаборатории.

Ключевые слова

Функция мозга Повреждение мозга Когнитивные расстройства Поведение человека Память Трансляционные модели на животных

Редакторы и филиалы

  1. 1., Факультет поведенческой нейробиологии Орегонский университет здоровья и науки Портленд, США,

Библиографическая информация

  • Заголовок книги Животные модели поведенческого анализа
  • Редакторы Якоб Рабер
  • Название серии Нейрометоды
  • Сокращенное название серии Нейрометоды
  • DOI https: // doi.org / 10.1007 / 978-1-60761-883-6
  • Информация об авторских правах Springer Science + Business Media, LLC 2011 г.
  • Имя издателя Humana Press, Тотова, Нью-Джерси
  • электронные книги Протоколы Springer
  • ISBN в твердом переплете 978-1-60761-882-9
  • ISBN в мягкой обложке 978-1-4939-5833-7
  • электронная книга ISBN 978-1-60761-883-6
  • Серия ISSN 0893-2336
  • Серия E-ISSN 1940-6045
  • Номер издания 1
  • Количество страниц XV, 354
  • Количество иллюстраций 0 ч / б иллюстраций, 0 иллюстраций в цвете
  • Темы Неврология
    Неврология
    Модели животных
  • Купить эту книгу на сайте издателя

генов | Бесплатный полнотекстовый | Ингибитор тирозил-ДНК-фосфодиэстеразы 1 (hTdp1) человека NSC120686 как исследовательский инструмент для изучения генов Tdp1 растений

1.Введение

Противораковое химиотерапевтическое средство камптотецин и его производные действуют как ингибиторы ДНК-топоизомеразы I (TopI, EC 5.99.1.2), улавливая фермент на ДНК и превращая временные комплексы расщепления TopI-ДНК в постоянные цитотоксические поражения [1]. Клетки удаляют эти стабилизированные комплексы расщепления TopI-ДНК за счет активности фермента тирозил-ДНК-фосфодиэстераза 1 (Tdp1, EC 3.1.4), который катализирует гидролиз ковалентной связи между каталитическим тирозиновым остатком TopI и 3'-концом фосфодиэфирной связи ДНК [2].У почкующихся дрожжей TopI-опосредованное повреждение ДНК также устраняется альтернативными путями с участием эндонуклеазных комплексов, среди которых Rad1-Rad10 (Radiation Insensitive 1–10) [3], в то время как в клетках человека ту же роль выполняет эндонуклеаза XPF (Xeroderma pigmentosum группа комплементации F) -ERCC1 (группа 1 кросс-комплементации с эксцизионной репарацией), критический компонент TC-NER (транскрипционно-связанная эксцизионная репарация нуклеотидов) [4]. Раковые клетки часто лишены этих альтернативных путей, таким образом полагаясь только на Tdp1-опосредованную репарацию, чтобы противостоять ядам TopI [5].По этой причине комбинированное использование ингибиторов TopI и Tdp1 в настоящее время рассматривается как многообещающая стратегия для повышения эффективности химиотерапии. Наиболее сильные ингибиторы человеческого фермента (hTdp1), идентифицированные до сих пор, классифицируются как миметики фосфотирозинового субстрата Tdp1, поскольку они имеют общие свойства. те же структурные особенности природного фосфотирозинового субстрата [6]. Соединение NSC120686 (2-хлор-6-фторбензальдегид 9H-флуорен-9-илиденгидразон), испытанное в настоящей работе, было идентифицировано Weidlich и его коллегами [7] как фармакофор, способный ингибировать активность hTdp1.Биологические эффекты NSC120686 были протестированы на клеточной линии IGROV-1 карциномы яичников человека и на двух производных суб-линиях (IGROV-1CPT / L и IGROV-1CPT / H), выбранных на устойчивость к производному камптотецина гиматекану. Эти линии показали повышенную экспрессию гена hTdp1, что подтверждает участие Tdp1 в клеточном ответе на лечение [8]. Дополнительная информация о биологических эффектах NSC120686 была предоставлена ​​Аль-Кейлани [9], который оценил эффективность комбинированной терапии, включающей ингибиторы hTdp1 и яды TopI.Молекула NSC120686 доставлялась в линию клеток злокачественной глиомы U87 в присутствии / в отсутствие различных препаратов топоизомеразы. При доставке в чистом виде обработка NSC120686 выявила сильную дозозависимую токсичность в отношении клеток U87, в то время как не наблюдали значительной корреляции между уровнем экспрессии гена hTdp1 и устойчивостью клеток к ингибитору. В настоящее время нет отчетов, описывающих влияние NSC120686 на клетки растений. Семейство генов Tdp1 из Medicago truncatula Gaertn.был впервые описан Macovei и его коллегами [10], в то время как другая работа охарактеризовала мутант tdp1, полученный путем мечения переносящей ДНК (тДНК) в Arabidopsis thaliana [11]. Гены MtTdp1α и MtTdp1β были активированы в ответ на тяжелые металлы и осмотические стрессы, а также во время набухания семян, когда требуется репарация ДНК для сохранения целостности генома и повышения жизнеспособности семян [10,12]. Впоследствии были получены трансгенные растения M. truncatula с посттранскрипционной подавляющей регуляцией гена MtTdp1α [13] и подвергнуты РНК-секвенированию (RNA-seq), которое выявило дифференциальную экспрессию генов восприятия / репарации повреждений ДНК и ремоделирования хроматина.Интересно, что ортологи M. truncatula генов млекопитающих и дрожжей, участвующих в путях репарации, альтернативных Tdp1, не подвергались повышенной регуляции в линиях, истощенных по MtTdp1α [13]. Кроме того, Sabatini et al. [14] продемонстрировали, что истощение гена MtTdp1α приводит к общему снижению метилирования цитозина и нарушениям в профилях экспрессии транспозонов / ретротранспозонов ДНК. Что касается динамики ингибирования фермента Tdp1 у растений, было продемонстрировано, что как полноразмерная комплементарная ДНК (кДНК) Arabidopsis Tdp1α, так и домен тирозил-ДНК-фосфодиэстеразы (TDP) сами по себе могут спасти чувствительность к ингибитору TopI камптотецину и к ванадату. аналоги (ингибиторы реакций переноса фосфорила) в мутантном штамме tdp1 / rad1 почкующихся дрожжей [15].При воздействии производных ванадата (которые напрямую связывают тирозин, имитируя фосфаты или действуют как аналоги переходной стадии [16]), мутантные растения Arabidopsis tdp1 показали значительно более высокую чувствительность к этим соединениям по сравнению с растениями дикого типа [15]. основанный на предположении, что исследование эффектов ингибиторов hTdp1 в клетках M. truncatula, своеобразной системе с двумя отдельными генами Tdp1, может помочь собрать новую информацию об их роли в этой модельной бобовой, что может иметь последствия для связанных видов, имеющих экономическое значение.Эта работа представляет собой оригинальную перспективу изучения реакции на повреждение ДНК у растений, которая до сих пор не рассматривалась. В настоящей работе мы приводим доказательства генотоксических эффектов NSC120686 в клетках растений с использованием каллусов, полученных из модельной бобовой M. truncatula. Исследование было расширено на каллусы M. truncatula, истощенные по MtTdp1α (линия Tdp1α-2a, [13]), с целью изучения возможных сходств / различий между ответом на лечение NSC120686 и ответом, связанным с истощением гена Tdp1α.

4. Обсуждение

Соединение NSC120686 не так давно было идентифицировано как ингибитор фермента hTdp1 [7]. Он действует как лиганд, который связывается с активным сайтом фермента и, таким образом, предотвращает его связывание с другими субстратами. С момента его выявления только в нескольких исследованиях сообщалось о его использовании в качестве предполагаемого противоопухолевого препарата в сочетании со специфическими ингибиторами TopI [8,9]. Это связано с тем, что при таком типе двойной обработки доступный фермент Tdp1, ответственный за гидролиз фосфодиэстеразной связи между ферментом TopI и ДНК, взаимодействует с ложными субстратами, тогда как разрывы ДНК, производимые ингибиторами TopI, продолжают накапливаться и вызывать гибель клеток.Кроме того, эти исследования также продвигают экспрессию гена hTdp1 в качестве прогностического агента для злокачественной глиомы, потому что активация гена была связана с повышенной агрессивностью опухоли [8,9,29], а уровни матричной РНК (мРНК) hTdp1 были обратно коррелированы с выживаемость пациентов [29]. У растений функции Tdp1 гораздо менее понятны по сравнению с достижениями в исследованиях человеческого Tdp1. Присутствие семейства генов Tdp1 в растениях (Tdp1α, Tdp1β) [10] добавляет еще один уровень сложности этой системе и еще больше увеличивает потребность в разработке специальных исследований для изучения их функций.Наши предыдущие исследования показали участие генов Tdp1 в DDR и стрессовой реакции [10,12,13,14,18,23,24,30]. Кроме того, подавление или мутации в каноническом гене Tdp1α привело к появлению карликовых растений у M. truncatula [13] и Arabidopsis [11], что подчеркивает его важную функцию в развитии растений. В этом исследовании впервые было использовано соединение NSC120686. время обработки растений M. truncatula calli. На уровне белка Tdp1 растений и животных имеет одну и ту же доменную организацию, и каталитические сайты вместе с консервативными аминокислотными остатками (HKD-I и HKD-II), отвечающими за его функцию, были обнаружены также у растений [10,11].Более того, на арабидопсисе было доказано, что рекомбинантный белок Tdp1 способен гидролизовать 3'-фосфотирозильные ДНК-субстраты, связанные с повреждениями, вызванными TopI-ДНК [15]. Основываясь на этих предпосылках, мы предположили, что NSC120686, ингибитор hTdp1, будет оказывать влияние также на клетки растений. Чтобы оценить, какое влияние это соединение оказывает на клетки растений, мы измерили несколько параметров, таких как жизнеспособность клеток, повреждение ДНК и экспрессия селективных генов DDR. Данные, собранные в результате этих анализов, обсуждаются с учетом имеющейся в настоящее время литературы по двум другим системам, а именно, линии истощенных по Tdp1α-2a, выращенных in vitro [13], и линий злокачественных клеток человека, обработанных NSC120686 [8,9].Мы наблюдали, что концентрация NSC120686 в 300 мкМ вызвала 50% гибели клеток M. truncatula (рис. 1b). При рассмотрении концентраций, используемых для индукции IC 50 (50% гибели клеток) в линиях злокачественных клеток, они варьировались от 10 мкМ в линии клеток IGROV-1 [8] до 50 мкМ в линии клеток U87 [9]. Следовательно, для индукции цитотоксического действия в растительных клетках требовалось 6-30-кратное увеличение концентрации NSC120686. Аналогичным образом было замечено, что обработанные камптотецином суспензии клеток моркови требовали в 10 раз больше соединения, чтобы вызвать повреждающий эффект [31].В том же исследовании было показано, что клетки моркови, истощенные по tdp1β, демонстрирующие повышенный уровень PCD, были устойчивы к камптотецину (ингибитор топоисмонеразы I) [31]. Также в нашем случае, когда 300 мкМ NSC120686 вводили в каллусы, полученные от Tdp1α-2a трансгенной линии M. truncatula, это не вызывало какой-либо значимой разницы (p = 0,11) по сравнению с необработанной трансгенной линией; аналогично, тип морфологии ядер PCD более распространен. Поскольку Tdp1α-2a лишен функции Tdp1α, это может указывать на то, что соединение «атакует» Tdp1α у растений; с другой стороны, каллусы Tdp1α-2a представляли низкий процент жизнеспособных клеток и усиление событий PCD даже до обработки соединением, и они сопоставимы с каллусами, обработанными NSC120686 дикого типа (300 мкМ) (рис. 1c).В то время как некроз, как правило, представляет собой острую реакцию гибели клеток, которая быстро развивается в ответ на стресс, гибель клеток типа PCD может происходить в основном во время более легких стрессов [32,33]. С другой стороны, похоже, что каллусы, обработанные NSC120686, имели прогрессивное и дозозависимое увеличение процента ядер, показывающих тип морфологии некроза (рис. 1c). Это свидетельствует о том, что лечение воспринимается как стрессовая ситуация. Помимо гибели клеток, каллусы дикого типа, обработанные NSC120686, также показали повышенные уровни повреждения ДНК (рис. 2b).Более того, накопление разрывов цепей также наблюдалось в трансгенной линии Tdp1α-2a, охарактеризованной в предыдущем исследовании [13]. Поскольку повреждение ДНК было доказано в ответ на лечение NSC120686, мы дополнительно оценили профили экспрессии селективных генов DDR (рисунок 4), выбранные на основе биоинформатического перекрестного поиска с использованием онлайн-инструментов вместе с ранее созданным набором данных RNA-seq для Tdp1α. -2а [13]. Сводка этих результатов, представленных вместе с данными из доступной в настоящее время литературы по Tdp1 растений и животных, представлена ​​в таблице 2.Начнем с того, что очень интересным результатом был тот факт, что два гена Tdp1 давали противоположный ответ, причем Tdp1α усиливался, а Tdp1β подавлялся при обработке NSC120686. Это можно интерпретировать как дополнительный признак того, что гены Tdp1α и Tdp1β могут иметь разные функции. Другими подсказками в этом отношении является тот факт, что: (1) в трансгенной линии Tdp1α-2a наблюдаемая повышающая регуляция гена Tdp1β не способна компенсировать отсутствие транскрипта Tdp1α [13], и (2) ген Tdp1β кажется более восприимчивым на ранних стадиях (первые часы после лечения) навязанного стресса, о чем свидетельствуют оба исследования M.truncatula и A. thaliana [24]. Последующее наблюдение могло бы состоять в том, что Tdp1α является геном, кодирующим канонический белок Tdp1; это наблюдение обусловлено тем фактом, что также в клеточных линиях человека повышенная регуляция гена Tdp1 наблюдалась в ответ на лечение NSC120686, что сопровождалось снижением уровня белка [8,9] (Таблица 2). У M. truncatula наблюдаемая повышающая регуляция гена Tdp1α может представлять механизм отрицательной обратной связи для компенсации функционального нарушения белка Tdp1, предполагаемого как возможный эффект лечения NSC120686.С другой стороны, подавление гена Tdp2α можно рассматривать как индикатор потери жизнеспособности клеток, поскольку наши предыдущие результаты показали, что избыточная экспрессия этого гена была связана с повышенной жизнеспособностью и пролиферацией клеток [30]. Более того, сверхэкспрессия Tdp2α коррелирует с повышенной способностью к репарации ДНК (в основном репарация DSB, что согласуется с его функцией в пути NHEJ [34]) и толерантностью к стрессу [18,23]. Напротив, на уровни экспрессии топоизомераз ДНК (Tdp1β и Top2) обработка NSC120686 не влияла, что, возможно, предполагает, что это соединение не вызывает топологических изменений в ДНК.В клетках животных Tdp1, как предполагается, в основном функционирует в рамках пути BER [34,35], тогда как другие альтернативные пути репарации Tdp1 также могут быть связаны с удалением Top1-опосредованных повреждений ДНК [3,4]. Следовательно, мы решили исследовать уровни экспрессии генов, функционирующих в альтернативных путях, таких как ERCC1 и XPF, играющих важную роль в NER, или MRE11, Rad50 и MUS81, которые действуют в репарации DSB (HR и NHEJ). Наши результаты показали, что в то время как гены ERCC1 и Rad50 были активированы, ген XPF подавлен, а MRE11 и MUS81 не выявляют значительных изменений в уровнях их экспрессии при обработке NSC120686.Ситуация была иной, когда профили экспрессии этих генов искали в наборе данных Tdp1α-2a RNA-seq [13] (Таблица 2). В этом случае не наблюдалось значительных изменений в уровнях транскриптов генов MRE11, Rad50, ERCC1, XPF и MUS81, что указывает на то, что клетки M. truncatula, лишенные функции Tdp1α, не полагаются на альтернативные пути репарации [13]. Поскольку обработка NSC120686 вызывает повышенную экспрессию гена Tdp1α, разумно обнаружить различную экспрессию этих генов по сравнению с системой, в которой отсутствует функция Tdp1α.Таким образом, наши результаты предполагают, что лечение NSC120686 влияет не только на гены Tdp1, но и на другие гены, играющие роль в альтернативных путях репарации. Аналогичным образом, когда исследовались профили предполагаемых взаимодействующих Tdp1α, при исследовании каллусов, обработанных NSC120686, и трансгенная линия Tdp1α-2a, выращенная in vitro (таблица 2). Единственным геном, который давал одинаковый ответ в двух разных условиях, был DRT100, участвующий в репарации абазических сайтов и SSB во время УФ-индуцированного повреждения ДНК и связанный с путем BER [42].Интересным моментом для обсуждения является повышающая регуляция как Tdp1α, так и PARP1 при самой низкой (75 мкМ) концентрации NSC120686, когда уровни повреждения ДНК и жизнеспособность клеток, по-видимому, не затрагиваются. Недавние исследования на клетках животных показали, что PARP1 спаривается с Tdp1 для репарации повреждений ДНК, вызванных TopI [45]. Прямое взаимодействие между N-концевым доменом Tdp1 и C-концевым доменом PARP1 приводит к парилированию Tdp1, что приводит к усиленному привлечению к участкам повреждения ДНК. Следовательно, в нашей ситуации разумно предположить, что Tdp1 и PARP1 могут рассматриваться как взаимодействующие партнеры также в растительных клетках, и что активация Tdp1α и PARP1 может предотвращать генотоксическое повреждение при низких концентрациях NSC120686.Напротив, модифицированные линии клеток глиомы U87, демонстрирующие либо сверхэкспрессию Tdp1, либо нокаут, не выявили каких-либо значительных изменений в паттернах экспрессии гена PARP1 [9]. Тем не менее, случай Tdp1-PARP1 намного сложнее, поскольку оба они считаются многоцелевыми белками, роль которых охватывает репарацию ДНК, ремоделирование хроматина, передачу клеточных сигналов и общее поддержание целостности генома [34,46]. В заключение, первое в истории исследование , проведенное на растениях с использованием ингибитора активности Tdp1 человека NSC120686, показывает, что это соединение способно вызывать генотоксическое повреждение и гибель клеток при использовании в высоких концентрациях.Несмотря на то, что уровни гибели клеток и накопления разрывов цепей сходны между клетками, обработанными NSC120686, и трансгенной линией Tdp1α-2a, лишенной функции Tdp1α, молекулярные механизмы, лежащие в основе этих ответов, по-видимому, различны. Это связано с тем, что в то время как NSC120686 должен влиять на белок Tdp1α, действие РНКи на Tdp1α осуществляется на уровне мРНК. Различные механизмы очевидны, что подтверждается различными паттернами экспрессии нескольких генов с известными функциями в ответе на повреждение ДНК между двумя системами.Однако нельзя исключать, что некоторые из этих расхождений могут быть связаны с использованием разных систем (каллусы против растений) или геномной изменчивостью; тем не менее, недавнее исследование показало наличие сходных профилей экспрессии генов в каллусах, выращенных in vitro, и проростках M. truncatula [47]. Таким образом, представленные результаты указывают на использование ингибитора hTdp1 в качестве инструмента для будущих исследований, направленных на расшифровку специфических ролей генов Tdp1 растений.

Пространственная и временная экспрессия факторов деполимеризации актина ADF7 и ADF10 во время развития мужских гаметофитов у Arabidopsis thaliana | Физиология растений и клетки

"> Абстракция

Актиновый цитоскелет играет решающую роль во многих аспектах развития растительных клеток.Во время развития мужских гаметофитов актиновые массивы заметно реконструируются как во время созревания пыльцы в пыльнике, так и после гидратации пыльцы на рецептивном рыльце и удлинении пыльцевой трубки. Ремоделирование актиновых массивов является результатом высокоорганизованной активности многочисленных актин-связывающих белков (ABP). Ключевым игроком в ремоделировании актина является фактор деполимеризации актина (ADF), который увеличивает скорость беговой дорожки актиновых волокон. Мы приготовили флуоресцентные белковые слияния двух ADF, специфичных для пыльцы Arabidopsis, ADF7 и ADF10.Мы отслеживали экспрессию и субклеточную локализацию этих белков во время развития мужских гаметофитов, прорастания пыльцы и роста пыльцевых трубок. ADF7 и ADF10 по-разному экспрессировались с сигналом ADF7, появляющимся на стадии микроспоры, и сигналом ADF10 только на стадии поляризованной микроспоры. ADF7 был связан с ядром микроспор и вегетативным ядром зрелого зерна на менее метаболически активных стадиях, но в прорастающих пыльцевых зернах и удлиненных пыльцевых трубках он был связан с субапикальной актиновой бахромой.С другой стороны, ADF10 был связан с нитчатым актином в развивающемся гаметофите, в частности с массивами, окружающими отверстия зрелого пыльцевого зерна. В хвостовике удлиненных пыльцевых трубок ADF10 был связан с толстыми актиновыми кабелями. Мы предлагаем возможные специфические функции этих двух ADF на основе их различий в экспрессии и локализации.

"> Введение

Актиновый цитоскелет выполняет в растительных клетках различные функции, некоторые из которых значительно отличаются от своих аналогов животных.Массивы актина являются структурной основой циклоза, быстрого движения органелл в цитоплазме растения (Woods et al. 1984), они связаны с фрагмопластом, конфигурацией цитоскелета, регулирующей цитокинез растения (Higaki et al. 2008), и они, по-видимому, таковы. участвовать в восприятии механических стимулов, например, приводящих к гравитропизму (Kordyum et al. 2009, Stanga et al. 2009). Актиновые филаменты также играют решающую роль в регуляции генерации формы клеток и инициации событий локального роста, которые приводят к морфогенезу сложных форм, характерных для определенных типов клеток растений (Smith and Oppenheimer 2005).В то время как в клетках млекопитающих актин-опосредованный морфогенез осуществляется за счет прямого воздействия сил, оказываемых полимеризацией и сокращением актина на окружающую плазматическую мембрану, считается, что морфогенетическая роль актина в растительных клетках осуществляется через нацеливание материала клеточной стенки на определенные поверхностные домены, предназначенные для размножения клеток (Mathur 2006, Geitmann and Dumais 2009). Однако как именно действует этот специфический для растений механизм, неизвестно. Следовательно, хотя известно, что динамика актина является решающей особенностью во время развития растений, его точная регулирующая роль во многих из этих онтогенетических процессов остается неуловимой.

Пространственная конфигурация актиновых массивов и их динамическое поведение в значительной степени контролируются активностью белков, которые влияют на полимеризацию актиновых филаментов, деполимеризацию, разветвление и связывание. Многие из белков, идентифицированных в клетках млекопитающих, также, как известно, экспрессируются в тканях растений с различной степенью сходства в аминокислотной последовательности и трехмерной структуре (McCurdy et al. 2001, Hussey et al. 2006, Yokota and Shimmen 2006). Одним из семейств белков, участвующих в контроле динамики актина растений, является фактор деполимеризации актина (ADF) / кофилин.ADF филогенетически консервативен у растений, животных и грибов (Hussey et al. 2002) и, как известно, специфически связывается с ADP-связанной формой как мономерного, так и нитчатого актина. Связывание ADF с нитчатым актином происходит преимущественно на заостренных концах, где это взаимодействие вызывает изменение спирального скручивания актиновой нити и ускоряет диссоциацию субъединиц актина (Lopez et al. 1996, Carlier et al. 1997, Jiang et al. 1997b). , McGough et al. 1997, Hussey et al. 1998, Bamburg 1999, Bowman et al.2000, Купер и Шафер 2000, Бамбург и Бернштейн 2008). В условиях ограниченного поступления мономера актина результирующая повышенная доступность мономера способствует полимеризации актиновых филаментов на зазубренном конце, тем самым ускоряя беговую дорожку (Carlier et al. 1997, Michelot et al. 2007). ADF / кофилин также способен разрезать актиновые филаменты, что уменьшает длину филаментов, но одновременно увеличивает количество доступных зазубренных концов, которые служат нуклеаторами для большей полимеризационной активности (Hayden et al.1993, Blanchoin и Pollard 1999, Staiger and Blanchoin 2006, Staiger et al. 2009 г.). Активность ADF / кофилина зависит от концентрации - он способствует разделению актина при низких концентрациях и индуцирует нуклеацию актина и сборку актина при более высоких концентрациях (Yeoh et al. 2002, Andrianantoandro and Pollard 2006). Способность ADF деполимеризовать актин также зависит от pH в щелочных условиях, благоприятствующих этому процессу (Carlier et al. 1997, Allwood et al. 2001, Chen et al. 2002).

Активность ADF контролируется состоянием фосфорилирования серинового остатка, присутствующего в N-концевой области белка (Smertenko et al.1998, Allwood et al. 2001, Чен и др. 2003 г.). Было обнаружено, что фосфорилирование ADF и, следовательно, активность ADF контролируется стимулируемой кальцием протеинкиназой, присутствующей в клетках растений (Smertenko et al. 1998). ADF также может быть инактивирован фосфатидилинозитолом (PI), фосфатидилинозитол-4-фосфатом (PIP) и фосфатидилинозитол-4,5-бифосфатом (PIP2) посредством их связывания с актин-связывающим доменом ADF (Yonezawa et al. 1990, 1991, Gungabissoon et al. 1998, Кусано и др. 1999). Было также обнаружено, что активность ADF контролируется Rop GTPases (Chen et al.2003), растительный член семейства Rho GTP-связывающих белков, обеспечивая тем самым нижележащий элемент, посредством которого многие регуляторные пути, вероятно, действуют на клеточный морфогенез.

Функциональный анализ ADF растений посредством подавления был затруднен из-за присутствия множества изоформ в геноме растения. В то время как одноклеточные эукариоты обычно обладают только одним геном ADF и одним ADF и двумя генами кофилина, обнаруженными в большинстве геномов позвоночных, несколько генов ADF существуют у большинства проанализированных видов высших растений (Maciver and Hussey 2002, Bamburg and Bernstein 2008).Семейство ADF в Arabidopsis thaliana включает 11 генов (Arabidopsis.org), которые разделены на четыре подкласса (Mun et al. 2000, Ruzicka et al. 2007). Член подкласса 1, ADF2 , как было показано, участвует в регуляции роста и дифференцировки растительных клеток, поскольку нокдаун RNAi мешает развитию растений (Clement et al. 2009). Предполагается, что члены подкласса 2, ADF7, , , ADF8, , , ADF10, и , ADF11, играют роль в росте кончика, типе сильно поляризованной активности роста, которая регулируется актиновым цитоскелетом.Транскриптомика и протеомика, анализы промотор-GUS и данные иммунолокализации показали, что ADF8 и ADF11 экспрессируются в трихобластах и ​​корневых волосках (Ruzicka et al. 2007), тогда как ADF7 и ADF10 специфически экспрессируются в пыльце и пыльце. пыльцевые трубки (Becker et al. 2003, Honys and Twell 2003, 2004, Noir et al. 2005, Pina et al. 2005, Hruz et al. 2008, Wang et al. 2008b, Qin et al. 2009, Zou et al. 2009 г.). Это согласуется с экспрессией ADF во время мужского гаметогенеза у риса (Hobo et al.2008 г.). Из-за экспрессии множества изоформ ADF даже в пределах отдельных типов клеток точные функции белков, специфичных для клеток, растущих на кончике, остаются неуловимыми. Однако подавление ADF в растущем на верхушках мхе Physcomitrella , который имеет только один ген, кодирующий ADF, серьезно препятствует росту верхушек (Augustine et al., 2008), тогда как частичное антисмысловое молчание увеличивает динамику актина и удлинение корневых волосков. у Arabidopsis (Dong et al. 2001).Это указывает на то, что регуляция динамики актина посредством активности ADF, вероятно, является решающим компонентом процесса роста верхушек у высших растений.

В нескольких функциональных исследованиях ADF в растительных клетках использовалась пыльцевая трубка, тип растительных клеток, растущих на верхушках, которые растут быстрее всех и, следовательно, можно ожидать, что они будут иметь чрезвычайно динамичный актиновый цитоскелет. Этот цилиндрический клеточный бугорок образуется пыльцой после контакта с восприимчивым рыльцем и может расти со скоростью до 3 мм / ч.Его цель - доставить неподвижные сперматозоиды от пыльцевого зерна к женскому гаметофиту, который расположен глубоко в тканях пестика. Важность актинового цитоскелета для процесса роста легко продемонстрировать с помощью лекарств, приводящих к деполимеризации актина, таких как латрункулин B (LatB) или цитохалазин, которые немедленно останавливают процесс (Гиббон ​​и др., 1999 г., Миллер и др., 1999 г., Видали и др. 2001, Gossot and Geitmann 2007). Основная функция актина в пыльцевых трубках носит логистический характер.Рост пыльцевой трубки требует доставки значительного количества материала мембраны и клеточной стенки к области растущей поверхности, чтобы поддерживать непрерывное удлинение на расстояния до многих сантиметров (Franklin-Tong 1999). Этот материал транспортируется секреторными пузырьками из тел Гольджи, расположенных где угодно в цитоплазме, в небольшую область на клеточной поверхности, где он необходим, на растущую верхушку (Bove et al. 2008, Zonia and Munnik 2008). Таким образом, везикулы и другие органеллы быстро перемещаются по трубке в двунаправленном движении, которое в значительной степени опосредовано миозином (Vidali and Hepler 2001) и происходит на актиновых филаментах, ориентированных в противоположных направлениях в периферийных и центральных областях цитоплазмы (Lenartowska and Michalska 2008). .Вблизи верхушки тонкая сетка актиновых филаментов формирует кортикальную бахрому (Lovy-Wheeler et al. 2005), которая колокализуется с щелочной цитоплазматической областью (Feijó et al. 1999). Почти нет актиновых филаментов на самом конце пыльцевой трубки, где пузырьки накапливаются во время переходной фазы между движением вперед и назад (Kroeger et al. 2009). Направление пузырьков в точно определенную кольцевую область вокруг полюса клетки считается решающим для создания идеально цилиндрической трубки, поскольку экзоцитоз должен находиться под жестким пространственным контролем для геометрически правильного морфогенеза (Cardenas et al.2008, Geitmann and Dumais 2009, Fayant et al. 2010), а также для контроля направления роста (наши собственные неопубликованные данные) и инвазивной активности (Gossot and Geitmann 2007). Решающую роль субапикального актинового края для морфогенеза можно продемонстрировать экспериментально, поскольку известно, что изменения в функционировании цитоскелета, вызванные лекарствами или мутациями, вызывают апикальный отек и, следовательно, потерю идеально полярной активности роста (Hepler et al. 2001, Cheung и Wu 2008, Yang 2008, Zerzour et al.2009 г.). Важно, что субапикальная бахрома и удлинение пыльцевой трубки более чувствительны к актин-деполимеризирующим средствам, чем транспорт органелл на большие расстояния, происходящий в цилиндрической ножке клетки (Vidali et al. 2001).

Чтобы актиновые массивы в быстрорастущей пыльцевой трубке сохраняли свою четко определенную пространственную конфигурацию и реагировали на внешние сигналы, их динамика должна строго регулироваться. Полимеризация актиновых филаментов, деполимеризация, разветвление, блокирование и связывание должны быть точно настроены для того, чтобы клетка могла выполнять определенные функции.ADF входит в число актин-связывающих белков (ABPs), которые, как известно, действуют в субапикальной актиновой кайме, как показано на трубках пыльцы табака и лилии (Chen et al. 2002, Lovy-Wheeler et al. 2006, Wilsen et al. 2006). Эта роль явно критическая, поскольку сверхэкспрессия NtADF1 ингибирует рост трубок пыльцы табака зависимым от концентрации образом (Chen et al. 2002, 2003). Точно так же сверхэкспрессия специфичного для пыльцы ADF хлопка ( GhADF7 ) снижает жизнеспособность пыльцы и уменьшает рост пыльцевых трубок (Li et al.2010).

Не только рост пыльцевой трубки, но и более ранние фазы развития мужских гаметофитов характеризуются точно скоординированным ремоделированием актинового цитоскелета (Heslop-Harrison et al. 1986, Tiwari and Polito 1988, Heslop-Harrison and Heslop-Harrison 1992, Танака и Вакабаяши 1992, Дерксен и др. 1995, Тейлор и Хеплер 1997, Кай и др. 2005). Без этой реорганизации цитоскелета прорастание пыльцы неизбежно завершится неудачей и оплодотворение станет невозможным (Gibbon et al.1999). Чтобы охарактеризовать потенциальную роль ADF в этой реорганизации цитоскелета, мы исследовали субклеточную локализацию ADF7 и ADF10, связанных с голубым флуоресцентным белком (CFP) и желтым флуоресцентным белком (YFP), соответственно, на разных стадиях развития пыльцы. в A. thaliana .

"> Результаты

"> Паттерн экспрессии ADF7 и ADF10 в Arabidopsis

Транскриптомные и протеомные данные показали, что у Arabidopsis ADF7 и ADF10 , по-видимому, специфически экспрессируются в пыльце (Becker et al.2003, Honys and Twell 2003, 2004, Noir et al. 2005, Пина и др. 2005, Ruzicka et al. 2007, Hruz et al. 2008 г., Ван и др. 2008b, Zou et al. 2009 г.). ADF7 и ADF10 имеют 94% сходства в своих аминокислотных последовательностях при использовании NCBI blast (Altschul et al. 1997). ADF7 имеет от 77% до 92% сходства с другими членами семейства ADF Arabidopsis, тогда как для ADF10 это сходство несколько ниже - 74–90%. ADF7 и ADF10 имеют> 90% сходства в своей аминокислотной последовательности с двумя другими членами ADF подкласса 2, т.е.е. ADF8 и ADF11. Прогнозный поиск возможных сигналов ядерного экспорта с использованием сервера NetNES 1.1 Технического университета Дании (la Cour et al. 2004) дал положительный пик для аминокислоты 21 для обоих ADF с оценкой 0,592 для ADF10 и 0,743 для ADF7. .

Для визуализации ADF7 и ADF10 мы трансформировали A. thaliana химерными ADF7 и ADF10 генами, помеченными генами CFP и YFP , соответственно, под контролем их соответствующего нативного промотора. и терминаторные последовательности.Чтобы оценить характер экспрессии гибридных белков в трансформированных растениях, мы исследовали экспрессию CFP и YFP в корнях, корневых волосках, стеблях, листьях, трихомах и всех органах цветка. За исключением мужского гаметофита, мы не наблюдали флуоресценции выше фонового уровня ни в одном из этих органов. Это подтверждает, что Arabidopsis ADF7 и ADF10 , когда они экспрессируются в виде флуоресцентных белковых химер под контролем их собственных промоторов, действительно являются пыльцевыми.Чтобы утверждать, что химерные гены не были значительно сверхэкспрессированы у мутантов, мы оценили их экспрессию в соцветии с помощью полуколичественной ОТ-ПЦР. Присутствие обоих химерных генов вызвало незначительное снижение экспрессии соответствующих нативных генов. Экспрессия ADF7 – CFP была на том же уровне (хотя и немного выше), чем у эндогена, а экспрессия ADF10 – YFP была значительно ниже, чем у соответствующего эндогена (дополнительный рис. S1).

"> Локализация ADF7 и ADF10 при развитии мужского гаметофита

Чтобы определить субклеточную локализацию ADF7 и ADF10 во время развития мужского гаметофита, мы собрали пыльцу разных стадий с трансформированных растений Arabidopsis и наблюдали их с помощью конфокальной микроскопии. Стадии развития аннотированы на основе описания морфологии гаметофитов Twell и соавторами (Borg et al. 2009). Для визуализации ядер пыльцевые зерна перед наблюдением также окрашивали 4'-6-диамидино-2-фенилиндолом (DAPI).

Экспрессия ADF7 – CFP впервые появилась на ранней стадии микроспор сразу после разделения тетрад. До этой стадии в развивающемся гаметофите не было видно значимой метки (не показано). После разделения на тетрад микроспоры, меченные ADF7-CFP, проявляли диффузную флуоресценцию в цитоплазме и немного более интенсивную метку в ядре (рис. 1А). На этой стадии экспрессия ADF10-YFP еще не была видна (не показана). На стадии поляризованных микроспор ADF7 – CFP все еще присутствует в ядре (рис.1B) и ADF10-YFP начали появляться в цитоплазме в виде коротких палочковидных агрегатов (Fig. 2A). Непосредственно перед двухклеточной стадией ADF7-CFP исчезает из ядра и диффузно метит цитоплазму (Fig. 1C), тогда как ADF10-YFP ассоциируется с более длинными нитевидными структурами в цитоплазме (Fig. 2B). На двухклеточной стадии некоторое количество ADF7-CFP накапливается вокруг вегетативного ядра и немного более плотные агрегаты начинают появляться на периферии цитоплазмы (Fig. 1D). На этой стадии развития ADF10-YFP, по-видимому, был связан с более длинными нитевидными структурами, часть которых была агрегирована вокруг вегетативного ядра, но большая часть была сконцентрирована на периферии клетки (рис.2С). На стадии зрелой пыльцы короткие нитчатые элементы, меченные ADF7-CFP, присутствовали вокруг вегетативного ядра, тогда как более длинные и более плотно упакованные филаменты доминировали на периферии цитоплазмы, которая также содержала диффузную флуоресценцию CFP (Fig. 1E). ADF10-YFP на этой стадии обнаруживает очень похожую локализацию с таковой на двухклеточной стадии с филаментозными структурами вокруг вегетативного ядра и плотной сеткой филаментов в основном на периферии цитоплазмы (Fig. 2D).Непосредственно перед цветением ADF7-CFP формирует плотную сетку из длинных филаментов на периферии цитоплазмы, и диффузная флуоресценция присутствует по всей цитоплазме и в вегетативном ядре (Fig. 1F). На апертурах интенсивность метки была выше. Перед цветением ADF10-YFP, с другой стороны, более специфично нацеливается на нитчатые структуры на периферии цитоплазмы с очень небольшой диффузной меткой и отсутствием флуоресценции в ядре (Fig. 2E). В пыльце открытых цветков ADF7 – CFP метил вегетативное ядро ​​и присутствовал в виде плотной нитевидной сетки на периферии с высокой концентрацией в отверстиях (рис.1F). Этикетка ADF10 – YFP имела форму более длинных и толстых нитей, расположенных в апертурах и ориентированных параллельно их длинным осям (рис. 2F). Оптические срезы и визуализация поверхности продемонстрировали, что метка была расположена на периферии цитоплазмы (рис. 3) и не обнаруживалась в центральных областях цитоплазмы.

Рис. 1

Экспрессия ADF7 – CFP на разных стадиях развития мужских гаметофитов. В первом столбце показаны максимальные проекции изображений Z-стека, полученных с помощью конфокального микроскопа, а во втором столбце показаны соответствующие срединные оптические сечения.Третий столбец представляет отдельные оптические секции тех же ячеек, помеченных DAPI, а четвертый столбец представляет соответствующие изображения светлого поля. Ядро микроспоры и вегетативные ядра указаны стрелкой. Масштабные линейки 10 мкм.

Рис. 1

Экспрессия ADF7 – CFP на разных стадиях развития мужских гаметофитов. В первом столбце показаны максимальные проекции изображений Z-стека, полученных с помощью конфокального микроскопа, а во втором столбце показаны соответствующие срединные оптические сечения.Третий столбец представляет отдельные оптические секции тех же ячеек, помеченных DAPI, а четвертый столбец представляет соответствующие изображения светлого поля. Ядро микроспоры и вегетативные ядра указаны стрелкой. Масштабные линейки 10 мкм.

Рис. 2

Экспрессия ADF10 – YFP на разных стадиях развития мужских гаметофитов. Первый столбец представляет собой проекции Z-изображений, полученных на конфокальном микроскопе. В первом столбце показаны максимальные проекции изображений Z-стека, полученных с помощью конфокального микроскопа, а во втором столбце показаны соответствующие срединные оптические сечения.Третий столбец представляет отдельные оптические секции тех же ячеек, помеченных DAPI, а четвертый столбец представляет соответствующие изображения светлого поля. Вегетативные ядра показаны стрелкой. Масштабные линейки 10 мкм.

Рис. 2

Экспрессия ADF10 – YFP на разных стадиях развития мужских гаметофитов. Первый столбец представляет собой проекции Z-изображений, полученных на конфокальном микроскопе. В первом столбце показаны максимальные проекции изображений Z-стека, полученных с помощью конфокального микроскопа, а во втором столбце показаны соответствующие срединные оптические сечения.Третий столбец представляет отдельные оптические секции тех же ячеек, помеченных DAPI, а четвертый столбец представляет соответствующие изображения светлого поля. Вегетативные ядра показаны стрелкой. Масштабные линейки 10 мкм.

Рис. 3

Изображение поверхности пыльцевого зерна на стадии раскрытия цветка, экспрессирующее ADF10 – YFP, показанное на рис. 2F. Только верхняя половина Z-стопки использовалась для выявления локализации ADF в периферийной области зерна.Две группы длинных волокон расположены у двух отверстий в половине зерна, показанной здесь. Масштабная линейка 5 мкм.

Рис. 3

Визуализирующее изображение поверхности пыльцевого зерна на стадии открытого цветка, экспрессирующего ADF10 – YFP, показанное на рис. 2F. Только верхняя половина Z-стопки использовалась для выявления локализации ADF в периферийной области зерна. Две группы длинных волокон расположены у двух отверстий в половине зерна, показанной здесь. Масштабная линейка 5 мкм.

"> ADF7 и ADF10 нацелены на актиновый цитоскелет

Для идентификации нитчатых структур, ассоциированных с метками ADF7 и ADF10, мы пометили зрелую пыльцу, экспрессирующую ADF7-CFP и ADF10-YFP из открытых цветков, родамином-фаллоидином после химической фиксации (рис. 4A, B, G, H). Пространственная конфигурация нитевидных структур, меченных для ADF и для актина, была почти идентична. Удивительно, но нитчатые структуры, меченные ADF7, часто были длиннее, чем соответствующие структуры, меченные фаллоидином (рис.3G, H). Возможное объяснение может заключаться в том, что ADF7-CFP стерически блокирует потенциальные сайты связывания фаллоидина на актиновых филаментах. Более того, было показано, что ADF-насыщенные актиновые филаменты теряют свои сайты связывания фаллоидина из-за изменений скручивания актиновых филаментов (Ressad et al. 1998, Bamburg 1999).

Рис. 4

Субклеточная локализация флуоресцентного ADF и актина, меченного родамином-фаллоидином, в зрелой пыльце открытых цветков. Первый столбец представляет метку ADF, второй столбец показывает актин, меченный родамином-фаллоидином, а последний столбец представляет собой соответствующее изображение в светлом поле.(D – F, J – L) Пыльцевые зерна обрабатывали LatB перед фиксацией и фаллоидиновой меткой. Некоторые более длинные филаменты, меченные ADF7, не были мечены фаллоидином (стрелка). Все флуоресцентные микрофотографии представляют собой максимальные проекции Z-стопок, полученные с помощью конфокального микроскопа. Стрелки указывают вегетативные ядра. Масштабные линейки 10 мкм.

Рис. 4

Субклеточная локализация флуоресцентного ADF и актина, меченного родамином-фаллоидином, в зрелой пыльце открытых цветков. Первый столбец представляет метку ADF, второй столбец показывает актин, меченный родамином-фаллоидином, а последний столбец представляет собой соответствующее изображение в светлом поле.(D – F, J – L) Пыльцевые зерна обрабатывали LatB перед фиксацией и фаллоидиновой меткой. Некоторые более длинные филаменты, меченные ADF7, не были мечены фаллоидином (стрелка). Все флуоресцентные микрофотографии представляют собой максимальные проекции Z-стопок, полученные с помощью конфокального микроскопа. Стрелки указывают вегетативные ядра. Масштабные линейки 10 мкм.

Для дальнейшего подтверждения природы нитчатых структур, меченных ADF7 и ADF10, мы вводили LatB на пыльцевые зерна. LatB - это токсин, выделенный из губки красного моря Latrunculia magnifica , который секвестрирует G-актин, что приводит к деполимеризации F-актина из-за продолжающейся разборки на минус-концах нитей (Gibbon et al.1999). После лечения LatB нитевидные структуры, меченные фаллоидином, частично или полностью исчезли (рис. 4E, K). Точно так же метка для ADF7 и ADF10 потеряла свою нитевидную конфигурацию (рис. 4D, J). Любые оставшиеся нитчатые структуры совпадают со структурами, меченными фаллоидином (рис. 4D, E, J, K). Диффузная флуоресценция ADF7 в цитоплазме сильно усилилась в результате обработки LatB (фиг. 4D). Интересно, что после обработки пыльцы распадающихся цветков LatB, ADF10 – YFP был ассоциирован с вегетативным ядром (рис.4D).

Массивы актина обычно очень динамичны. Чтобы оценить, ведут ли ADF-меченные структуры аналогичным образом, мы получили покадровые серии гидратированных пыльцевых зерен из открытых цветков мутантов ADF7 – CFP и ADF10 – YFP . Структуры, помеченные CFP и YFP, были очень динамичными (дополнительные видео 1, дополнительные данные), что согласуется с поведением актиновых филаментов.

"> Локализация ADF7 и ADF10 в прорастающей пыльце и пыльцевой трубке

Для прорастания пыльцы требуется доставка секреторных пузырьков к отверстию (Cresti et al.1977, 1985), а актиновый цитоскелет, как известно, формирует характерные массивы до и во время прорастания (Heslop-Harrison et al. 1986, Tiwari and Polito 1988, Heslop-Harrison and Heslop-Harrison 1992, Tanaka and Wakabayashi 1992, Derksen et al. 1995 г., Тейлор и Хеплер 1997 г., Кай и др. 2005 г.). Чтобы оценить, участвует ли ADF7 или ADF10 в ремоделировании актинового цитоскелета до и во время прорастания пыльцы, мы поместили зрелую пыльцу в среду прорастания на 1 час перед наблюдением.Когда пыльцевое зерно начало прорастать, нитевидные элементы, помеченные ADF7-CFP, исчезли из зерна и оказались связанными с длинными нитевидными кабелями, по-видимому, намотанными на кончик только что появившейся трубки (рис. 5A). В недавно разработанных пыльцевых трубках (<60 мкм) филаменты, меченные ADF7-CFP, были связаны с кончиком трубки, и значительное количество диффузной метки было видно на стержне клетки (рис. 5B) и в пыльцевом зерне. . В более старых пыльцевых трубках (> 60 мкм) ADF7-CFP нацелился на длинные нитевидные кабели в субапикальной области трубки и по всей области стержня (рис.5С).

Рис. 5

Локализация ADF7 – CFP в прорастающих пыльцевых зернах Arabidopsis (A), в короткой пыльцевой трубке (B) и в длинной пыльцевой трубке (C). Все микрофотографии представляют собой максимальные проекции Z-стопок, полученные с помощью конфокального микроскопа. Масштабные линейки 10 мкм.

Рис. 5

Локализация ADF7 – CFP в прорастающих пыльцевых зернах Arabidopsis (A), в короткой пыльцевой трубке (B) и в длинной пыльцевой трубке (C). Все микрофотографии представляют собой максимальные проекции Z-стопок, полученные с помощью конфокального микроскопа.Масштабные линейки 10 мкм.

В прорастающих пыльцевых зернах, экспрессирующих ADF10 – YFP , флуоресценция была ограничена периферией появляющейся пыльцевой трубки (рис. 6А). Когда трубка почти достигла длины, соответствующей диаметру зерна, большая часть этикетки оказалась внутри трубки, и в зерне почти не осталось этикетки. Метка была связана с более длинными нитевидными структурами, которые были плотно упакованы (фиг. 6B) и, как можно было наблюдать, образуют петли (фиг. 6C). По сравнению с ADF7-CFP количество отдельных нитей, меченных ADF10-YFP, казалось намного выше, а их расположение более плотным (сравните рис.4A с фиг. 5B). По мере того, как трубка продолжала расти, флуоресцентная метка для ADF10-YFP становилась более концентрированной в суб вершине, где она формировала более короткие филаменты (Fig. 6D). Пыльцевые зерна с более длинными трубками отображали несколько толстых кабелей, которые продолжались от зерна в трубку (рис. 6E, F). Менее выраженная, но четко видимая метка была связана с субапикальной бахромой в более длинной трубке пыльцевой трубки (рис. 6G, H). Чтобы подтвердить природу нитчатой ​​структуры в пыльцевых трубках, пыльцевые трубки, экспрессирующие ADF10 – YFP, фиксировали и метили на актин с помощью родамин – фаллоидин.Паттерны меток для флуоресценции YFP и родамина были идентичны (фиг. 7), подтверждая, что ADF связан с актиновым цитоскелетом.

Рис. 6

Локализация ADF10 – YFP в прорастающих пыльцевых зернах Arabidopsis (A, B, C), в короткой пыльцевой трубке (D, F) и в длинных пыльцевых трубках (E, G). (C) - пыльцевое зерно с двумя выходящими пыльцевыми трубками. (H) - увеличенное изображение кончика пыльцевой трубки на (G) с усилением контраста, показывающее актиновую полосу.Все микрофотографии представляют собой максимальные проекции Z-стопок, полученные с помощью конфокального микроскопа. Масштабные линейки 10 мкм.

Рис. 6

Локализация ADF10 – YFP в прорастающих пыльцевых зернах Arabidopsis (A, B, C), в короткой пыльцевой трубке (D, F) и в длинных пыльцевых трубках (E, G). (C) - пыльцевое зерно с двумя выходящими пыльцевыми трубками. (H) - увеличенное изображение кончика пыльцевой трубки на (G) с усилением контраста, показывающее актиновую полосу. Все микрофотографии представляют собой максимальные проекции Z-стопок, полученные с помощью конфокального микроскопа.Масштабные линейки 10 мкм.

Рис. 7

Пыльцевая трубка Arabidopsis, экспрессирующая ADF10-YFP (B), меченный родамином-фаллоидином (A). Изображения представляют собой максимальные проекции Z-стека изображений, полученных с помощью апотома Zeiss. Масштабная линейка 10 мкм.

Рис. 7

Пыльцевая трубка Arabidopsis, экспрессирующая ADF10-YFP (B), меченный родамином-фаллоидином (A). Изображения представляют собой максимальные проекции Z-стека изображений, полученных с помощью апотома Zeiss. Масштабная линейка 10 мкм.

"> Обсуждение

Ремоделирование актина имеет большое значение в процессе оплодотворения растений, поскольку движение секреторных пузырьков и, следовательно, сборка клеточной стенки в растущей пыльцевой трубке основывается на транспортировке актомиозина (DePina and Langford 1999, Geitmann and Steer 2006, Yokota и Шиммен 2006).Ремоделирование актина происходит во время развития мужских гаметофитов, гидратации пыльцевых зерен и продолжается во время прорастания пыльцы (Heslop-Harrison et al. 1986, Tiwari and Polito 1988, Heslop-Harrison and Heslop-Harrison 1992, Tanaka and Wakabayashi 1992, Derksen et al. 1995, Тейлор и Хеплер 1997, Кай и др. 2005). Динамика актина зависит от активности нескольких ABPs, включая членов семейства ADF, некоторые из которых экспрессируются или специфичны для пыльцы.

Учитывая, что мужской гаметофит экспрессирует несколько изоформ ADF , мы подозревали, что они могут иметь различные функции и различаться по своему временному профилю экспрессии или субклеточной локализации.Мы сосредоточились на ADF7 и ADF10 , которые оба специфически экспрессируются в пыльце, но функции которых не охарактеризованы. Мы выбрали метод конструирования химерных генов с внутренне флуоресцентными белками, который соблюдает три условия. Во-первых, наша стратегия сохранила естественные уровни экспрессии белков с помощью их природных промоторных и терминаторных последовательностей. Это было важно, поскольку изменение уровня экспрессии, например, с использованием промотора с высокой экспрессией, такого как Lat52, может изменить функцию белка и повлиять на рост клеток, особенно при высокодинамичном и чувствительном росте кончика пыльцевой трубки.Было продемонстрировано, что сверхэкспрессия нескольких генов в пыльцевой трубке вызывает отек, снижение скорости роста, аномальную морфологию и измененную субклеточную организацию (Кост и др., 1999, Ли и др., 1999, Фу и др., 2001, Чен и др., 2002, с. 2003, Гу и др. 2003, Чунг и Ву 2004, Бош и Хеплер 2005, Юн и др. 2006, Чанг и др. 2007, Фритч и др. 2007, Ишебек и др. 2008, Рёкель и др. 2008, Соуза и др. др. 2008 г., Ван и др. 2008а, Йе и др. 2009 г.). Во-вторых, мы использовали всю последовательность гена, включая интроны.Было показано, что интроны обладают эффектом усиления на экспрессию генов (Rose 2008), особенно в генах актина (McElroy et al. 1990, Jeong et al. 2009) и ABPs (Jeong et al. 2006). Экспрессия Petunia ADF в Arabidopsis была особенно усилена присутствием первого интрона (Mun et al. 2002, Jeong et al. 2007). В-третьих, чтобы сохранить сайты связывания, функциональные домены и правильное нацеливание белков, избегали вставки флуоресцентного белка в эти конкретные сайты.Используемая здесь методика высокопроизводительного флуоресцентного мечения полноразмерного белка (FTFLP) (Tian et al. 2004) учитывала эти три условия и была явно успешной, поскольку пыльцевые зерна прорастали и формировали трубочки идеальной формы, морфология которых была неотличима от морфологии диких растений. растения типа. Важно отметить, что уровни экспрессии трансгенов не были значительно выше, чем у соответствующих нативных генов в растениях дикого типа (дополнительный рисунок S1). Кроме того, паттерн экспрессии гена соответствовал предсказанному с помощью данных транскриптомной, протеомной и белковой иммуномаркировки (Honys and Twell 2003, 2004, Pina et al.2005, Ruzicka et al. 2007) с исключительной экспрессией в мужском гаметофите и отсутствием во всех других органах. Это подтверждает, что наша стратегия трансформации сохранила уровни нативной экспрессии и временные и пространственные профили экспрессии в процессе развития.

Конфокальная лазерная сканирующая микроскопия на разных стадиях развития гаметофита показала, что ADF7 и ADF10 демонстрируют разные паттерны экспрессии и субклеточной локализации. ADF7 экспрессировался раньше, начиная со стадии микроспор сразу после разделения тетрад, тогда как ADF10 был виден только на стадии поляризованных микроспор.ADF7 показал ядерную локализацию на этих ранних стадиях и на поздней стадии пыльцевого зерна. Неясно, какую роль играет ADF в ядре. Было показано, что АДФ / кофилин проникает в ядро ​​в клетках животных, подвергшихся стрессу (Sanger et al. 1980, Nishida et al. 1987, Lida et al. 1992, Yahara et al. 1996) и в клетки корня кукурузы, обработанные цитохалазином D. (Цзян и др. 1997b). Однако, хотя у позвоночных ADF и cofilin есть последовательность ядерной локализации, которая позволяет им шаперонировать актин в ядре (Bamburg and Bernstein 2008), эти последовательности не были обнаружены в ADFs растений.Тем не менее, о локализации ADF в ядре растений сообщалось с использованием иммуномаркировки (Jiang et al. 1997a, Ruzicka et al. 2007, Augustine et al. 2008). Было предложено два объяснения ядерной локализации. ADF в ядре может служить для защиты актина и уменьшения потери АТФ из-за динамики актина. В качестве альтернативы, актин и ADF входят в ядро, чтобы осуществить ремоделирование хроматина, чтобы гарантировать структурную стабильность ядра и внести свой вклад в правильную экспрессию гена за счет возможного воздействия ADF на актин и, следовательно, на активность РНК-полимеразы (Jockusch et al.2006 г.).

Наши данные показали, что ассоциация ADF7 с ядром ограничивается микроспорами и стадиями поляризованных микроспор. Во время последующих стадий развития ADF7 больше не был связан с ядром, пока не вернулся в ядро ​​на поздних стадиях созревания. Этот временной ход предполагает, что ADF7 отсутствует в ядре во время высокой метаболической активности, связанной с делением клеток, и присутствует в ядре во время стадий низкой метаболической активности, таких как микроспора и поздняя зрелая или спящая пыльца.Это согласуется с представлением о том, что ядерная локализация может служить формой хранения либо ADF, либо ADF-связанного актина, который может быть задействован, когда этого требует деление клеток или прорастание пыльцы. В отличие от ADF7, ADF10 не локализуется в ядре ни на одной из наблюдаемых здесь стадий развития, но он проникает в ядро ​​после обработки LatB. Поскольку наш поиск последовательности показал, что и ADF7, и ADF10 обладают положительным пиком для сигналов ядерного экспорта с оценкой 0,743 и 0,592 соответственно, возможно, что оценка ADF10 ниже порога для нормального ядерного экспорта и позволяет нацеливать ADF10 на ядро ​​только во время стрессовые условия.Стресс-индуцированное поведение ADF10 согласуется с представлением о том, что ADF ингибирует денатурацию актина, подтверждая гипотезу, что актин упакован в ядро, чтобы защитить его во время стресса и сделать его доступным после снятия стресса (Hayden et al. 1993).

ADF10 не экспрессировался в мужском гаметофите Arabidopsis до стадии поляризованных микроспор. Метка ADF10 гораздо чаще ассоциировалась с более длинными актиновыми филаментами, чем ADF7. Он также показал более плотное распределение вокруг отверстий (сравните рис.6G с F). Эти различия указывают на то, что ADF10 выполняет другую функцию от ADF7 и что он скорее может участвовать в регулировании динамики актина, необходимой для физического процесса прорастания пыльцевой трубки, возможно, гарантируя, что массив актина правильно направляет пузырьки к месту появления пыльцевой трубки. Это согласуется с тем фактом, что разные гены ADF , экспрессируемые в одном и том же типе клеток, демонстрируют различные уровни экспрессии, которые могут быть связаны с функциональным разнообразием (Zhang et al.2007). Наши данные согласуются с драматическими изменениями, наблюдаемыми в уровнях экспрессии многих генов во время развития микрогаметофитов (Fujita et al. 2010).

В коротких пыльцевых трубках ADF7, по-видимому, был более обильным в субапикальной области кончика пыльцевой трубки, чем ADF10, что указывает на важную роль ADF7 в начальной фазе процесса расширения клеток, происходящего на вершине появляющейся пыльцевой трубки. В пыльцевых трубках одной и той же стадии развития ADF10 был больше сконцентрирован на толстых пучках актиновых филаментов в стержне пыльцевой трубки и в зерне, что указывает на то, что ADF10 имеет функцию маркировать более старые филаменты для обновления.Остается неизвестным, где снова используются мономеры актина, высвобожденные из этих дистальных филаментов. Конечно, можно ожидать, что они будут потребляться на кончике пыльцевой трубки, поскольку удлиненная трубка требует непрерывного продвижения субапикальной каймы и, следовательно, значительной активности полимеризации актина. Однако даже в области стержня трубки полимеризация актина может продолжаться. Увеличенное количество филаментов может служить для образования более толстых пучков актина, которые могут гарантировать эффективный транспорт органелл на большие расстояния и непрерывную доставку пузырьков к апикальной зоне.Это подтверждается представлением о том, что актомиозин-обеспечиваемый везикулярный транспорт, как известно, происходит быстрее на сильно связанных актиновыми филаментами (Holweg 2007). Уровень экспрессии ADF в данной клетке может влиять на субклеточную локализацию и, следовательно, модулировать специфические субклеточные функции. Временная экспрессия NtADF1 в пыльце табака под контролем промотора Lat52, как наблюдали, заставляла этот белок нацеливаться на более толстые актиновые кабели в высокоэкспрессируемых пыльцевых зернах, тогда как в зернах с более низким уровнем экспрессии метка была связана с более тонкими кабелями (Chen et al. .2002). Предпочтительная ассоциация ADF10 с толстыми пучками актина в стержне пыльцевых трубок, следовательно, может быть следствием его относительно высокого уровня экспрессии по сравнению с ADF7.

Следует отметить, что интерпретация профилей экспрессии ADF и субклеточной локализации должна выполняться с осторожностью, поскольку присутствие ADF не обязательно означает, что белок активен. Фосфорилирование способно дезактивировать АДФ (Смертенко и др., 1998, Олвуд и др.2001, Чен и др. 2003), даже если он остается связанным с актином. С другой стороны, фосфоинозитиды также способны инактивировать ADF (Yonezawa et al. 1990, 1991, Gungabissoon et al. 1998, Kusano et al. 1999) путем связывания с актин-специфическим сайтом свободного ADF. Тот факт, что диффузная цитоплазматическая метка более распространена для ADF7, чем для ADF10, может быть результатом либо более низкого сродства ADF7 к актину, либо другого стационарного равновесия между связанным и свободным ADF, либо другого механизма контроля, основанного на связывании фосфоинозитида.Другие белки также могут по-разному регулировать активность ADF7 и ADF10. Например, было показано, что Lily ADF активируется взаимодействующим с актином белком 1 (AIP1) (Allwood et al. 2002). Наконец, хотя мы качественно сравнили интенсивность флуоресценции ADF7 – CFP и ADF10 – YFP, прямое количественное сравнение, конечно, запрещено, поскольку для получения изображений использовались разные лазеры и световые каналы.

Наши данные ясно показывают, что ADF7 и ADF10 демонстрируют разные пространственные профили, причем ADF7 показывает ядерную локализацию на стадиях более низкой клеточной активности, тогда как ADF10 появляется в ядре только после воздействия стресса.Это указывает на то, что ADF7 отвечает за обеспечение присутствия запаса актин-ADF в ядре, который может быть активирован, когда это необходимо для деления клеток или образования пыльцевых трубок, тогда как ADF10 защищает актин от денатурации во время стрессовых условий. Хотя ADF7 маркирует актиновые филаменты на периферии пыльцевого зерна, ADF10 обнаруживает более сильную локализацию в периферической цитоплазме развивающегося гаметофита, в отверстиях, в зерне после прорастания и на кончике молодой удлиняющейся пыльцевой трубки.В удлиненных пыльцевых трубках ADF10, по-видимому, экспрессируется более высоко, чем ADF7, и он связан со старыми актиновыми филаментами, вероятно, пометив их для повторного использования. ADF7 с другой стороны, по-видимому, участвует в быстром обороте, который характеризует субапикальный актиновый край и является критическим для нацеливания пузырьков на растущую поверхность (Kroeger et al. 2009). Известно, что динамика актиновых филаментов в бахромке имеет решающее значение для роста пыльцевой трубки, поскольку ее потеря приводит к потере полярности и, в конечном итоге, к остановке роста (Cardenas et al.2005), а способность пыльцевой трубки перенаправлять свой рост при применении внешних триггеров ставится под угрозу (наши собственные неопубликованные данные). Различия в профилях экспрессии и субклеточной локализации между ADF7 и ADF10 суммированы на фиг. 8. Различные профили предполагают, что существует разделение труда между разными изоформами ADF в мужском гаметофите Arabidopsis. Доказательства этой концепции ждут экспериментальных доказательств того, вызывает ли подавление любого из белков дифференциальные эффекты на развитие пыльцы, удлинение пыльцевых трубок и контроль поляризованного и направленного роста.Точно так же важно определить, являются ли отдельные изоформы ADF мишенями различных сигнальных путей.

Рис. 8

Распределение ADF7 – CFP (голубой) и ADF10 – YFP (желтый) в развивающемся мужском гаметофите, прорастающей пыльце и удлиненной пыльцевой трубке A. thaliana . Элементы нарисованы не в масштабе. Пунктирная линия указывает положение одного из трех отверстий. Для простоты ядра в проросшей пыльце не показаны.

Рис. 8

Распределение ADF7 – CFP (голубой) и ADF10 – YFP (желтый) в развивающемся мужском гаметофите, прорастающей пыльце и удлиненной пыльцевой трубке A. thaliana . Элементы нарисованы не в масштабе. Пунктирная линия указывает положение одного из трех отверстий. Для простоты ядра в проросшей пыльце не показаны.

"> Материалы и методы

"> Флуоресцентное маркирование и нативная экспрессия ADF

Для воспроизведения уровня экспрессии и паттерна целевого гена конструкция включала 5'-нетранслируемую область (UTR) и промоторные последовательности (около 1000 п.н.), кодирующую область с интронами, а также 3'-UTR и терминаторную область.Чтобы свести к минимуму дальнейшее влияние флуоресцентной метки на нативную субклеточную локализацию и функцию химерного белка, местоположение метки относительно целевого гена было определено на основе компьютерных предсказаний фолдинга белка и функциональных доменов. Растения Arabidopsis, экспрессирующие ADF7 (At4g25590) и ADF10 (At5g52360), были получены с использованием техники FTFLP (Tian et al. 2004). Два набора праймеров, P1 – P2 и P3 – P4, были разработаны для амплификации каждого из генов-мишеней в двух фрагментах.P1 и P4 содержали сайты рекомбинации attB1 и attB2 соответственно в дополнение к ген-специфическим последовательностям. P2 и P3 содержали специфичные для генов последовательности и специфичные для флуоресцентных меток последовательности. ADF7 был помечен голубым вариантом желтого флуоресцентного белка (CFP), тогда как ADF10 был помечен YFP. Обе метки содержали обогащенный глицином линкерный пептид на N-конце и богатый аланином линкерный пептид на C-концевой области для уменьшения помех фолдингу белка (Tian et al. 2004).Последовательности праймеров ADF7: P1, 5 'gctcgatccacctaggctatcgctgaaacgaggaacagaaag 3'; P2, 5 'cacagctccacctccacctccaggccggcccactgccatccccgacgc 3'; P3, 5 'tgctggtgctgctgcggccgctggggccgaggacgagtgcaagctgaag 3' и P4, 5 'cgtagcgagaccacaggatcctttctaatgtgcgttgtggtt 3'.

Праймерные последовательности ADF10: P1, 5'-gctcgatccacctaggctcaatctgtttgcgctttcttttatt-3 '; P2, 5'-cacagctccacctccacctccaggccggcccaccgccatccccgacgc-3 '; P3, 5’-tgctggtgctgctgcggccgctggggccgaggacgagtgtaagctgaag-3 'и P4, 5’-cgtagcgagaccacaggacgaaagtgagctattacacgagaa-3'.

Флуоресцентная метка была объединена с двумя фрагментами ПЦР с использованием тройной матричной ПЦР с прямым праймером, содержащим сайт attB1 5'-ggggacaagtttgtacaaaaaagcaggctgctcgatccacctaggct-3 'и обратный праймер, содержащий сайт attB2 5'-ggggacgaccacta. Отдельные фрагменты ПЦР амплифицировали с использованием ДНК-полимеразы Phusion (Finnzymes), а тройную матричную ПЦР выполняли с использованием ДНК-полимеразы ExTaq (TaKaRa). ДНК экстрагировали из геля с использованием набора для экстракции гелей QIAquick (Qiagen).Конечные фрагменты ПЦР вводили в вектор входа pDONR Zeo (Invitrogen) с использованием реакции рекомбинации BP (Invitrogen) в соответствии с промышленным руководством. Секвенирование использовалось для проверки положительных клонов. Химерный ген вводили в вектор-приемник pBIN-GW (Tian et al. 2004) с использованием реакции рекомбинации LR (Invitrogen) в соответствии с руководством производителя. Экстракцию плазмиды из бактерий проводили с помощью минипрепарата QIAprep spin (Qiagen).

"> Растительный материал и рост пыльцевых трубок

А.thaliana Col-0 выращивали в почве при температуре день / ночь 22–20 ° C, при относительной влажности 60% в камерах для выращивания с циклом 16 ч свет / 8 ч темный свет. Для роста пыльцевой трубки in vitro пыльцу собирали с цветков во время цветения. Проращивание проводили в среде для выращивания пыльцевых трубок Arabidopsis в течение 5 ч, как описано в Bou Daher et al. (2009). Для сбора микроспор на разных стадиях развития цветки препарировали под стереомикроскопом и для наблюдения устанавливали только гаметофиты из длинных пыльников.

"> Мечение актина и ДНК

После 5 часов роста пробирки с пыльцой Arabidopsis были химически зафиксированы в течение 40 секунд в микроволновой печи (PELCO Cold Spot® Biowave 34700) при мощности 150 Вт в 3% формальдегиде, 0,5% глутаральдегиде и 0,05% растворе Triton X-100 в буфере. состоящий из 100 мМ ТРУБ, 5 мМ MgSO 4 и 0,5 мМ CaCl 2 при pH 9. Затем пыльцевые пробирки трижды промывали по 1 мин в том же буфере, затем инкубировали в течение ночи при 4 ° C в родамин-фаллоидин ( Molecular Probes) в буфере, состоящем из 100 мМ PIPES, 5 мМ MgSO 4 ,0.5 мМ CaCl 2 и 10 мМ EGTA при pH 7. На следующий день пыльцу промывали пять раз по 1 мин в том же буфере. Все этапы промывки проводили в микроволновой печи при 150 Вт. Затем пыльцу помещали на предметные стекла в каплю Citifluor (Electron Microscopy Sciences), покрывали покровным стеклом, герметизировали и немедленно наблюдали в микроскопе. ДНК метили, помещая гаметофиты в раствор DAPI с концентрацией 1 мкг / мл в среде пыльцы Arabidopsis. Для обработки LatB пыльцу инкубировали в среде Arabidopsis, содержащей 100 нМ LatB, до фиксации и мечения актина.

  • "> Микроскопические наблюдения
  • гаметофитов Arabidopsis из линий, экспрессирующих флуоресцентные белки, наблюдали в микроскопе Zeiss Imager-Z1®, оборудованном для микроскопии со структурированным освещением (Apotome), и камерой Zeiss AxioCam MRm. Использовался комплект фильтров возбуждения ВР 450–490, светоделителя FT 510 и излучения ВР 515–565. Для конфокальной визуализации использовался конфокальный микроскоп системы Zeiss LSM 510 META / LSM 5 LIVE / Axiovert 200M. Для возбуждения YFP использовали аргоновый лазер 488 нм, а для возбуждения CFP - 458 нм.Для визуализации поверхности и отображения вида изнутри пыльцевого зерна верхняя половина Z-стека использовалась для создания трехмерной реконструкции половины зерна с использованием функции внутреннего 4D программного обеспечения AxioVision 4.8 (Zeiss).

  • "> Полуколичественная RT-PCR
  • Суммарную РНК экстрагировали из цветков Arabidopsis (дикого типа, ADF7-CFP и ADF10-YFP) с использованием реагента Trizol (Invitrogen). Пять микрограмм использовали для синтеза кДНК с использованием SuperScript® III First-Strand Synthesis SuperMix (Invitrogen).Эндогены ADF7 и ADF10 амплифицировали с использованием в качестве прямого праймера: 5'-GAACGCGGCGTCGGGGATG-3 'и в качестве обратных праймеров: 5'-GAGCTTGCATACACCATCTTC-3' и 5'-GAGCTCGCATACACCATCTTC-3 'соответственно. Для амплификации только трансгена был выбран соответствующий прямой праймер для флуоресцентного белка: 5'-CACTACCTGAGCACCCAGT-3 'и 5'-GCAGCGTGCAGCTCGCCGAC-3' для ADF7 – CFP и ADF10 – YFP соответственно. Амплифицированные фрагменты были получены из 25 циклов с использованием 58 ° C для отжига и времени элонгации 45 с.В общей сложности 5 мкл каждой реакции загружали в препаративный 1% (мас. / Об.) Агарозный гель, окрашенный бромидом этидия, и интенсивность полос на фотографиях определяли количественно с помощью программного обеспечения ImageJ (http://rsbweb.nih.gov/ij/ ). Уровни экспрессии эндогена в трансгенных линиях использовали в качестве контрольного значения для экспрессии после нормализации на основе профиля экспрессии актина.

  • "> Финансирование
  • Эта работа была поддержана грантами Совета по естественным наукам и инженерным исследованиям Канады (NSERC) и фонда Québécois de la Recherche sur la Nature et les Technologies (FQRNT) для A.G.

  • "> Благодарности
  • Авторы хотели бы поблагодарить профессора Наташу Райхель за любезно предоставленные плазмиды p-Citrine3, p-CFP и pMN-GW.

    "> Сокращения

      Аббревиатуры

    • ADF

      Фактор деполимеризации актина

    • CFP

    • DAPI

      4'-6-диамидино-2-фенилиндол

    • 900FP Y

      000 желтый флуоресцентный белок

  • "> Список литературы
  • , , , , , , и другие.

    Регулирование пыльцево-специфического актин-деполимеризирующего фактора LlADF1

    ,

    Plant Cell

    ,

    2002

    , vol.

    14

    (стр.

    2915

    -

    2927

    ),,.

    Фосфорилирование актин-деполимеризирующего фактора растений с помощью протеинкиназы кальмодулин-подобного домена

    ,

    FEBS Lett.

    ,

    2001

    , т.

    499

    (стр.

    97

    -

    100

    ),,,,, и др.

    Gapped BLAST и PSI-BLAST: новое поколение программ поиска в базе данных белков

    ,

    Nucleic Acids Res.

    ,

    1997

    , т.

    25

    (стр.

    3389

    -

    3402

    ),.

    Механизм оборота актиновых филаментов путем разделения и нуклеации при различных концентрациях ADF / кофилин

    ,

    Мол. Ячейка

    ,

    2006

    , т.

    24

    (стр.

    13

    -

    23

    ),,,.

    Фактор деполимеризации актина важен для жизнеспособности растений, и его фосфорегуляция важна для роста кончиков

    ,

    Plant J.

    ,

    2008

    , т.

    54

    (стр.

    863

    -

    875

    ).

    Белки семейства ADF / кофилин: важные регуляторы динамики актина

    ,

    Annu. Rev. Cell Dev. Биол.

    ,

    1999

    , т.

    15

    (стр.

    185

    -

    230

    ),.

    ADF / cofilin

    ,

    Curr. Биол.

    ,

    2008

    , т.

    18

    (стр.

    R273

    -

    R275

    ),,,,.

    Транскрипционное профилирование тканей Arabidopsis выявляет уникальные характеристики транскриптома пыльцы

    ,

    Plant Physiol.

    ,

    2003

    , т.

    133

    (стр.

    713

    -

    725

    ),.

    Механизм взаимодействия актофорина Acanthamoeba (АДФ / кофилин) с актиновыми филаментами

    ,

    J. Biol. Chem.

    ,

    1999

    , т.

    274

    (стр.

    15538

    -

    15546

    ),,.

    Развитие мужских гаметофитов: молекулярная перспектива

    ,

    J. Exp. Бот.

    ,

    2009

    , т.

    60

    (стр.

    1465

    -

    1478

    ),.

    Пектинметилэстеразы и динамика пектина в пыльцевых трубках

    ,

    Plant Cell

    ,

    2005

    , vol.

    17

    (стр.

    3219

    -

    3226

    ),,.

    Оптимизация условий прорастания в холодильнике Arabidopsis thaliana пыльца

    ,

    Plant Cell Rep.

    ,

    2009

    , vol.

    28

    (стр.

    347

    -

    357

    ),,,,,.

    Величина и направление динамики пузырьков в растущих пыльцевых трубках с использованием пространственно-временной корреляционной спектроскопии изображений и восстановления флуоресценции после фотообесцвечивания

    ,

    Plant Physiol.

    ,

    2008

    , т.

    147

    (стр.

    1646

    -

    1658

    ),,,,,.

    Сравнительный структурный анализ семейства ADF / кофилин

    ,

    Proteins

    ,

    2000

    , vol.

    41

    (стр.

    374

    -

    384

    ),,,.

    Цитоскелет пыльцы во время прорастания и роста трубки

    ,

    Curr. Sci.

    ,

    2005

    , т.

    89

    (стр.

    1853

    -

    1860

    ),,,.

    Колебания роста пыльцевых трубок и уровни внутриклеточного кальция обратимо модулируются полимеризацией актина

    ,

    Plant Physiol.

    ,

    2008

    , т.

    146

    (стр.

    1611

    -

    1621

    ),,,.

    Полимеризация актина способствует изменению направления потока в верхушке пыльцевых трубок

    ,

    Cell Motil. Цитоскель.

    ,

    2005

    , т.

    61

    (стр.

    112

    -

    127

    ),,,,, и др.

    Фактор деполимеризации актина (ADF / кофилин) увеличивает скорость оборота филаментов: участие в подвижности на основе актина

    ,

    J. Cell Biol.

    ,

    1997

    , т.

    136

    (стр.

    1307

    -

    1322

    ),,,,.

    Предполагаемый кальций-проницаемый канал, управляемый циклическими нуклеотидами, CNGC18, регулирует рост поляризованных пыльцевых трубок

    ,

    J. Integr. Plant Biol.

    ,

    2007

    , т.

    49

    (стр.

    1261

    -

    1270

    ),,.

    Фактор деполимеризации актина опосредует регулируемый Rac / Rop GTPase рост пыльцевых трубок

    ,

    Plant Cell

    ,

    2003

    , vol.

    15

    (стр.

    237

    -

    249

    ),,,,, и др.

    Регуляция организации актина с помощью актин-деполимеризующего фактора в удлиненных пыльцевых трубках

    ,

    Plant Cell

    ,

    2002

    , vol.

    14

    (стр.

    2175

    -

    2190

    ),.

    Сверхэкспрессия формина Arabidopsis стимулирует образование избыточного актинового кабеля из клеточной мембраны пыльцевой трубки

    ,

    Plant Cell

    ,

    2004

    , vol.

    16

    (стр.

    257

    -

    269

    ),.

    Структурные и сигнальные сети для аппарата роста полярных клеток в пыльцевых трубках

    ,

    Annu. Rev. Plant Biol.

    ,

    2008

    , т.

    59

    (стр.

    547

    -

    572

    ),,,,, и др.

    Опосредованная актин-деполимеризирующим фактором 2 динамика актина важна для нематодной инфекции Arabidopsis

    ,

    Plant Cell

    ,

    2009

    , vol.

    21

    (стр.

    2963

    -

    2979

    ),.

    Контроль сборки и разборки актина на концах филаментов

    ,

    Curr. Opin. Cell Biol.

    ,

    2000

    , т.

    12

    (стр.

    97

    -

    103

    ),,,.

    Ультраструктура пыльцы Nicotiana alata , ее прорастание и раннее трубкообразование

    ,

    Am. J. Bot.

    ,

    1985

    , т.

    72

    (стр.

    719

    -

    727

    ),,,.

    Прорастание и раннее развитие трубок in vitro из Пыльца Lycopersicum peruvianum : ультраструктурные особенности

    ,

    Planta

    ,

    1977

    , vol.

    136

    (стр.

    239

    -

    247

    ),.

    Транспорт везикул: роль актиновых филаментов и миозиновых моторов

    ,

    Microsc. Res. Tech.

    ,

    1999

    , т.

    47

    (стр.

    93

    -

    106

    ),,,,,.

    Количественный анализ распределения органелл в трубках пыльцы табака: влияние на экзоцитоз и эндоцитоз

    ,

    Protoplasma

    ,

    1995

    , vol.

    188

    (стр.

    267

    -

    276

    ),,,,,.

    Белки ADF участвуют в контроле цветения и регулируют организацию F-актина, рост клеток и рост органов у Arabidopsis

    ,

    Plant Cell

    ,

    2001

    , vol.

    13

    (стр.

    1333

    -

    1346

    ),,,,,.

    Конечно-элементная модель полярного роста в пыльцевых трубках

    ,

    Plant Cell

    ,

    2010

    , vol.

    22

    (стр.

    2579

    -

    2593

    ),,,,.

    Растущие пыльцевые трубки имеют щелочную полосу в прозрачной зоне и кислотный кончик, зависящий от роста.

    ,

    J.Cell Biol.

    ,

    1999

    , т.

    144

    (стр.

    483

    -

    496

    ).

    Сигнализация и модуляция роста пыльцевой трубки

    ,

    Plant Cell

    ,

    1999

    , vol.

    11

    (стр.

    727

    -

    738

    ),,,,, и др.

    Циклический нуклеотид-управляемый канал необходим для роста пыльцы на поляризованном кончике

    ,

    Proc. Natl Acad. Sci. США

    ,

    2007

    , т.

    104

    (стр.

    14531

    -

    14536

    ),,.

    ROP GTPase-зависимая динамика локализованного на кончике F-актина контролирует рост кончика в пыльцевых пробирках

    ,

    J. Cell Biol.

    ,

    2001

    , т.

    152

    (стр.

    1019

    -

    1032

    ),,,,, и др.

    Атлас экспрессии риса в репродуктивном развитии

    ,

    Physiol.

    ,

    2010

    , т.

    51

    (стр.

    2060

    -

    2081

    ),.

    Not-so-tip-growth

    ,

    Сигнал растений. Behav.

    ,

    2009

    , т.

    4

    (стр.

    136

    -

    138

    ),. .

    Архитектура и свойства клеточной стенки пыльцевой трубки

    ,

    Пыльцевая трубка: клеточная и молекулярная перспектива

    ,

    2006

    Heidelberg

    Springer

    (стр.

    177

    -

    200

    ),,.

    Латрункулин B по-разному влияет на прорастание пыльцы и рост трубок

    ,

    Plant Cell

    ,

    1999

    , vol.

    11

    (стр.

    2349

    -

    2364

    ),.

    Рост пыльцевой трубки: преодоление механических препятствий задействует цитоскелет

    ,

    Planta

    ,

    2007

    , vol.

    226

    (стр.

    405

    -

    416

    ),,,.

    ROP GTPase регуляция роста пыльцевых трубок через динамику локализованного на кончике F-актина

    ,

    J. Exp. Бот.

    ,

    2003

    , т.

    54

    (стр.

    93

    -

    101

    ),,,,.

    Взаимодействие актин-деполимеризующего фактора кукурузы с актином и фосфоинозитидами и его ингибирование растительной фосфолипазы C

    ,

    Plant J.

    ,

    1998

    , т.

    16

    (стр.

    689

    -

    696

    ),,,.

    Анализ взаимодействия фактора деполимеризации актина с G- и F-актином

    ,

    Biochemistry

    ,

    1993

    , vol.

    32

    (стр.

    9994

    -

    10004

    ),,.

    Рост поляризованных клеток у высших растений

    ,

    Annu. Rev. Cell Dev. Биол.

    ,

    2001

    , т.

    17

    (стр.

    159

    -

    187

    ),,,,.

    Актин во время прорастания пыльцы

    ,

    J. Cell Sci.

    ,

    1986

    , т.

    86

    (стр.

    1

    -

    8

    ),.

    Прорастание моноколпатной пыльцы покрытосеменных: эволюция актинового цитоскелета и стенки во время гидратации, активации и прорастания трубки

    ,

    Ann. Бот.

    ,

    1992

    , т.

    69

    (стр.

    385

    -

    394

    ),,,.

    Количественный анализ изменений вклада актиновых микрофиламентов в развитие клеточной пластинки в цитокинезе растений

    ,

    BMC Plant Biol.

    ,

    2008

    , т.

    8

    стр.

    80

    ``,,, и др.

    Различные профили пространственно-временной экспрессии генов, экспрессируемых пыльниками, у риса

    ,

    Physiol.

    ,

    2008

    , т.

    49

    (стр.

    1417

    -

    1428

    ).

    Живые маркеры актина блокируют миозин-зависимую подвижность органелл растений и ауксин

    ,

    Cell Motil. Цитоскель.

    ,

    2007

    , т.

    64

    (стр.

    69

    -

    81

    ),.

    Сравнительный анализ транскриптома пыльцы Arabidopsis

    ,

    Plant Physiol.

    ,

    2003

    , т.

    132

    (стр.

    640

    -

    652

    ),.

    Транскриптомный анализ развития гаплоидных мужских гаметофитов Arabidopsis

    ,

    Genome Biol.

    ,

    2004

    , т.

    5

    стр.

    R85

    ,,,,, и др.

    Genevestigator V3: эталонная база данных экспрессии для метаанализа транскриптомов

    ,

    2008

    Каир

    Hindawi Publishing Corporation

    ,,.

    Актин-связывающие белки в базе данных генома Arabidopsis: свойства функционально различных растительных актин-деполимеризующих факторов / кофилинов

    ,

    Phil. Пер. R. Soc. Лондон. Серия Б: Биол. Sci.

    ,

    2002

    , т.

    357

    (стр.

    791

    -

    798

    ),,.

    Контроль актинового цитоскелета в росте растительных клеток

    ,

    Annu. Rev. Plant Biol.

    ,

    2006

    , т.

    57

    (стр.

    109

    -

    125

    ),,,,.

    Микроинъекция пыльцевого специфического актин-деполимеризирующего фактора, ZmADF1, переориентирует нити F-актина в Tradescantia волосковых клетках тычинок

    ,

    Plant J.

    ,

    1998

    , vol.

    14

    (стр.

    353

    -

    357

    ),,.

    Фосфатидилинозитол-4-фосфат-5-киназы типа B опосредуют рост пыльцевых трубок Arabidopsis и Nicotiana tabacum , регулируя секрецию апикального пектина

    ,

    Plant Cell

    ,

    2008

    , vol.

    20

    (стр.

    3312

    -

    3330

    ),,,,,.

    Роль первого интрона в экспрессии генов Arabidopsis ( Arabidopsis thaliana ) для актина и актин-связывающих белков

    ,

    Plant Sci.

    ,

    2009

    , т.

    176

    (стр.

    58

    -

    65

    ),,,,.

    Верхняя область в первом интроне актин-деполимеризующего фактора петунии 1 влияет на тканеспецифическую экспрессию у трансгенного Arabidopsis ( Arabidopsis thaliana )

    ,

    Plant J.

    ,

    2007

    , т.

    50

    (стр.

    230

    -

    239

    ),,,,,.

    Определенные роли первых интронов в экспрессии членов семейства гена профилина Arabidopsis

    ,

    Plant Physiol.

    ,

    2006

    , т.

    140

    (стр.

    196

    -

    209

    ),,.

    Фактор деполимеризации актина кукурузы, ZmADF3, перераспределяется к растущим кончикам удлиненных корневых волосков и может быть индуцирован к транслокации в ядро ​​с помощью актина

    ,

    Plant J.

    ,

    1997

    , т.

    12

    (стр.

    1035

    -

    1043

    ),,,.

    Связывание F-актина и G-актина не связано мутацией консервативных остатков тирозина в факторе деполимеризации актина кукурузы (ZmADF)

    ,

    Proc. Natl Acad. Sci. США

    ,

    1997

    , т.

    94

    (стр.

    9973

    -

    9978

    ),,,.

    Отслеживание различных форм ядерного актина

    ,

    Trends Cell Biol.

    ,

    2006

    , т.

    16

    (стр.

    391

    -

    396

    ),,,,. ,,,.

    Роль цитоскелета в силовой чувствительности растительных клеток

    ,

    Растительный цитоскелет: ключевой инструмент для агробиотехнологии

    ,

    2009

    Нидерланды

    Springer

    (стр.

    173

    -

    196

    ),,,, ,,.

    Гомологи Rac и компартментализованный фосфатидилинозитол 4, 5-бисфосфат действуют по общему пути, регулируя рост полярных пыльцевых трубок

    ,

    J.Cell Biol.

    ,

    1999

    , т.

    145

    (стр.

    317

    -

    330

    ),,,.

    Ориентация микрофиламентов ограничивает поток пузырьков и пространственное распределение в растущих пыльцевых трубках

    ,

    Biophys. J.

    ,

    2009

    , т.

    97

    (стр.

    1822

    -

    1831

    ),,.

    Обнаружение последовательности, участвующей в связывании актина и фосфоинозитида на N-концевой стороне кофилина

    ,

    Mol. Клетка. Biochem.

    ,

    1999

    , т.

    190

    (стр.

    133

    -

    141

    ),,,,,.

    Анализ и прогнозирование сигналов ядерного экспорта с высоким содержанием лейцина

    ,

    Protein Eng. Des. Sel.

    ,

    2004

    , т.

    17

    (стр.

    527

    -

    536

    ),.

    Организация и полярность актиновых филаментов в пыльцевых трубках, выявленных украшением субфрагмента 1 миозина II

    ,

    Planta

    ,

    2008

    , vol.

    228

    (стр.

    891

    -

    896

    ),,,,.

    Контроль роста кончика пыльцевой трубки с помощью поп-ГТФазы-зависимого пути, который приводит к локализованному на кончику притоку кальция

    ,

    Plant Cell

    ,

    1999

    , vol.

    11

    (стр.

    1731

    -

    1742

    ),,,,, и др.

    Три гена хлопка, предпочтительно экспрессируемые в тканях цветка, кодируют актин-деполимеризующие факторы, которые участвуют в динамике F-актина в клетках

    ,

    J. Exp. Бот.

    ,

    2010

    , т.

    61

    (стр.

    41

    -

    53

    ),,.

    Последовательность KKRKK участвует в индуцированной тепловым шоком ядерной транслокации действующего связывающего белка массой 18 кДа, кофилина

    ,

    Cell Struct. Функц.

    ,

    1992

    , т.

    17

    (стр.

    39

    -

    46

    ),,,,, и др.

    Пыльце-специфическая экспрессия генов кукурузы, кодирующих белки, подобные фактору деполимеризации актина

    ,

    Proc. Natl Acad. Sci. США

    ,

    1996

    , т.

    93

    (стр.

    7415

    -

    7420

    ),,,,.

    Колебательное повышение щелочности опережает рост и может регулировать динамику актина в пыльцевых трубках лилии

    ,

    Plant Cell

    ,

    2006

    , vol.

    18

    (стр.

    2182

    -

    2193

    ),,,.

    Усиленная фиксация показывает, что апикальный кортикальный край актиновых филаментов является неотъемлемой частью пыльцевой трубки

    ,

    Planta

    ,

    2005

    , vol.

    221

    (стр.

    95

    -

    104

    ),.

    Семейство ADF / кофилин: белки, ремоделирующие актин

    ,

    Genome Biol.

    ,

    2002

    , т.

    3

    стр.

    отзыва 3007 [Epub 26 апреля]

    .

    Локальные взаимодействия формируют клетки растений

    ,

    Curr. Opin. Cell Biol.

    ,

    2006

    , т.

    18

    (стр.

    40

    -

    46

    ),,.

    Актин и актин-связывающие белки у высших растений

    ,

    Protoplasma

    ,

    2001

    , vol.

    215

    (стр.

    89

    -

    104

    ),,,.

    Выделение эффективного промотора актина для использования в трансформации риса

    ,

    Plant Cell

    ,

    1990

    , vol.

    2

    (стр.

    163

    -

    171

    ),,,.

    Кофилин изменяет поворот F-актина: влияние на динамику актиновых филаментов и клеточную функцию

    ,

    J. Cell Biol.

    ,

    1997

    , т.

    138

    (стр.

    771

    -

    781

    ),,,,, и др.

    Стохастическая динамика актин-филамент, опосредованная АДФ / кофилином

    ,

    Curr. Биол.

    ,

    2007

    , т.

    17

    (стр.

    825

    -

    833

    ),,,.

    Роль актина в морфогенезе корневых волосков: исследования с липохито-олигосахаридом как стимулятором роста и цитохалазином как лекарством, нарушающим актин

    ,

    Plant J.

    ,

    1999

    , vol.

    17

    (стр.

    141

    -

    154

    ),,,,, и др.

    Актин-деполимеризующий фактор петунии в основном накапливается в сосудистой ткани, и его экспрессия генов усиливается первым интроном

    ,

    Gene

    ,

    2002

    , vol.

    292

    (стр.

    233

    -

    243

    ),,,,, и др.

    Две близкородственные кДНК, кодирующие актин-деполимеризирующие факторы петунии, в основном экспрессируются в вегетативных тканях

    ,

    Gene

    ,

    2000

    , vol.

    257

    (стр.

    167

    -

    176

    ),,,,,.

    Кофилин является компонентом внутриядерных и цитоплазматических актиновых стержней, индуцированных в культивируемых клетках

    ,

    Proc. Natl Acad. Sci. США

    ,

    1987

    , т.

    84

    (стр.

    5262

    -

    5266

    ),,,,.

    Справочная карта Arabidopsis thaliana протеом зрелой пыльцы

    ,

    Biochem. Биофиз. Res. Commun.

    ,

    2005

    , т.

    337

    (стр.

    1257

    -

    1266

    ),,,.

    Анализ семейства генов транскриптома пыльцы Arabidopsis выявляет биологические последствия для роста клеток, контроля деления и регуляции экспрессии генов

    ,

    Plant Physiol.

    ,

    2005

    , т.

    138

    (стр.

    744

    -

    756

    ),,,,, и др.

    Проникновение стигмы и стиля вызывает новый транскриптом в пыльцевых трубках, указывая на гены, критические для роста пестика

    ,

    PLoS Genet.

    ,

    2009

    , т.

    5

    стр.

    e1000621

    ``,,, и др.

    Кинетический анализ взаимодействия актин-деполимеризующего фактора (ADF) / кофилина с G- и F-актинами

    ,

    J.Биол. Chem.

    ,

    1998

    , т.

    273

    (стр.

    20894

    -

    20902

    ),,,,.

    Продуманная пространственная структура PME и PMEI клеточной стенки на кончике пыльцевой трубки включает эндоцитоз PMEI и отражает распределение этерифицированных и деэтерифицированных пектинов

    ,

    Plant J.

    ,

    2008

    , vol.

    53

    (стр.

    133

    -

    143

    ).

    Интрон-опосредованная регуляция экспрессии гена

    ,

    Процессинг ядерной пре-мРНК в растениях

    ,

    2008

    Берлин

    Springer

    (стр.

    277

    -

    290

    ),,,,.

    Гены древних подклассов Arabidopsis ACTIN DEPOLYMERIZING FACTOR проявляют новую и дифференциальную экспрессию

    ,

    Plant J.

    ,

    2007

    , vol.

    52

    (стр.

    460

    -

    472

    ),,,.

    Обратимая транслокация цитоплазматического актина в ядро, вызванная диметилсульфоксидом

    ,

    Proc. Natl Acad. Sci. США

    ,

    1980

    , т.

    77

    (стр.

    5268

    -

    5272

    ),,,,,.

    Ser6 в актин-деполимеризирующем факторе кукурузы, ZmADF3, фосфорилируется стимулируемой кальцием протеинкиназой и необходим для контроля функциональной активности

    ,

    Plant J.

    ,

    1998

    , vol.

    14

    (стр.

    187

    -

    193

    ),.

    Пространственный контроль роста клеток цитоскелетом растений

    ,

    Annu. Rev. Cell Dev. Биол.

    ,

    2005

    , т.

    21

    (стр.

    271

    -

    295

    ),,.

    Arabidopsis phosphatidylinositol-4-monophosphate 5-kinase 4 регулирует рост и полярность пыльцевых трубок, модулируя рециклинг мембран

    ,

    Plant Cell

    ,

    2008

    , vol.

    20

    (стр.

    3050

    -

    3064

    ),.

    Динамика актина: старые друзья с новыми историями

    ,

    Curr. Opin. Plant Biol.

    ,

    2006

    , т.

    9

    (стр.

    554

    -

    562

    ),,,,,.

    В динамике актиновых филаментов преобладают быстрый рост и расслаивающая активность кортикального массива Arabidopsis

    ,

    J. Cell Biol.

    ,

    2009

    , т.

    184

    (стр.

    269

    -

    280

    ),,,,. ,.

    Сигнализация в гравитропизме растений

    ,

    Сигнализация в растениях

    ,

    2009

    Берлин

    Springer

    (стр.

    209

    -

    237

    ),.

    Организация актина и цитоскелета микротрубочек перед прорастанием пыльцы

    ,

    Planta

    ,

    1992

    , vol.

    186

    (стр.

    473

    -

    482

    ),.

    Прорастание пыльцы и рост трубок

    ,

    Annu. Rev. Plant Physiol. Завод Мол. Биол.

    ,

    1997

    , т.

    48

    (стр.

    461

    -

    491

    ),,,, и др.

    Высокопроизводительное флуоресцентное мечение продуктов гена Arabidopsis полной длины in planta

    ,

    Plant Physiol.

    ,

    2004

    , т.

    135

    (стр.

    25

    -

    38

    ),.

    Пространственная и временная организация актина во время гидратации, активации и прорастания пыльцы у Pyrus communis L .: популяционное исследование

    ,

    Protoplasma

    ,

    1988

    , vol.

    147

    (стр.

    5

    -

    15

    ),.

    Актин и рост пыльцевой трубки

    ,

    Protoplasma

    ,

    2001

    , т.

    215

    (стр.

    64

    -

    76

    ),,.

    Полимеризация актина необходима для роста пыльцевых трубок

    ,

    Мол.Биол. Ячейка

    ,

    2001

    , т.

    12

    (стр.

    2534

    -

    2545

    ),,.

    Актин-связывающий белок, LlLIM1, опосредует кальций и водородную регуляцию динамики актина в пыльцевых трубках.

    ,

    Plant Physiol.

    ,

    2008

    , т.

    147

    (стр.

    1619

    -

    1636

    ),,,,,. Анализ транскриптома

    показывает изменения в экспрессии генов, сопровождающие прорастание пыльцы и рост трубок у Arabidopsis

    ,

    Plant Physiol.

    ,

    2008

    , т.

    148

    (стр.

    1201

    -

    1211

    ),,,,,.

    Визуализация актинового цитоскелета в растущих пыльцевых трубках

    ,

    Пол. Завод Репрод.

    ,

    2006

    , т.

    19

    (стр.

    51

    -

    62

    ),,.

    Ответ на холодовой стресс в растительных клетках I. Изменения циклоза и структуры цитоплазмы

    ,

    Protoplasma

    ,

    1984

    , т.

    121

    (стр.

    8

    -

    16

    ),,,,, и др.

    Роль кофилина / дестрина в реорганизации актинового цитоскелета в ответ на стрессы и клеточные стимулы

    ,

    Cell Struct. Функц.

    ,

    1996

    , т.

    21

    стр.

    4

    .

    Передача сигналов клеточной полярности у арабидопсиса

    ,

    Annu. Rev. Cell Dev. Биол.

    ,

    2008

    , т.

    24

    (стр.

    551

    -

    575

    ),,,,,,.

    Arabidopsis formin3 управляет образованием актиновых кабелей и поляризованным ростом в пыльцевых трубках

    ,

    Plant Cell

    ,

    2009

    , vol.

    21

    (стр.

    3868

    -

    3884

    ),,,.

    Определение различий в связывании актина человеческим ADF и кофилином

    ,

    J. Mol. Биол.

    ,

    2002

    , т.

    315

    (стр.

    911

    -

    925

    ),. .

    Актиновый цитоскелет в пыльцевых трубках: актин и связывающие актин белки

    ,

    Пыльцевая трубка: клеточная и молекулярная перспектива

    ,

    2006

    Берлин

    Springer

    (стр.

    139

    -

    155

    ),,, ,.

    Короткая последовательность, отвечающая как за связывание фосфоинозитидов, так и за актин-связывающую активность кофилина

    ,

    J. Biol. Chem.

    ,

    1991

    , т.

    266

    (стр.

    17218

    -

    17221

    ),,,,.

    Ингибирование взаимодействий кофилина, дестрина и дезоксирибонуклеазы I с актином фосфоинозитидами

    ,

    J. Biol. Chem.

    ,

    1990

    , т.

    265

    (стр.

    8382

    -

    8386

    ),,,.

    Изоформы кальцийзависимой протеинкиназы в Petunia выполняют различные функции в росте пыльцевых трубок, включая регулирование полярности

    ,

    Plant Cell

    ,

    2006

    , vol.

    18

    (стр.

    867

    -

    878

    ),,.

    Полярный рост пыльцевых трубок связан с пространственно ограниченными динамическими изменениями механических свойств клеток

    ,

    Dev. Биол.

    ,

    2009

    , т.

    334

    (стр.

    437

    -

    446

    ),,,,, и др.

    Молекулярная характеристика четырех генов ADF, дифференциально экспрессируемых в хлопке

    ,

    J. Genet. Геномика

    ,

    2007

    , т.

    34

    (стр.

    347

    -

    354

    ),.

    Динамика движения везикул и визуализация зон экзоцитоза и эндоцитоза в трубках пыльцы табака

    ,

    J. Exp. Бот.

    ,

    2008

    , т.

    59

    (стр.

    861

    -

    873

    ),,,,,.

    Сравнительный протеомный анализ зрелой пыльцы и проросшей пыльцы Arabidopsis

    ,

    J. Integr. Plant Biol.

    ,

    2009

    , т.

    51

    (стр.

    438

    -

    455

    )

    © Автор 2011.Опубликовано Oxford University Press от имени Японского общества физиологов растений. Все права защищены. Для получения разрешения обращайтесь по электронной почте: [email protected]

    Крупные кудри на средние волосы по химии. Как долго действует биозавивка? Подбор бигуди

    Кудри. Такой объемный и упругий. Они создают впечатление головы на голове и идеально подходят для тонких волос. Конечно, проще всего сделать химическую завивку, тогда вам не придется спать на бигуди или часами завивать локоны щипцами.В чем особенность крупной химической завивки, и какие еще есть способы получить шикарные локоны?

    Особенности большой завивки

    Большая химия имеет массу преимуществ, в отличие от мелкой химической завивки локоны непринужденно смотрятся и естественно ниспадают. Но, прежде чем решиться на эту процедуру, желательно знать некоторые моменты.


    Характеристики:

    1. Крупные локоны не подходят для редких волос, потому что на фоне объемных локонов будут проступать сквозь виски в месте пробора.Тонкая, но нормальной плотности украсит химия.
    2. Подходит для длинных и средних волос, на короткие пряди не оказывает никакого воздействия, кроме пышности.
    3. Не требует ежедневного ухода, а прическа сохраняет внешний вид от 3 недель до 3 месяцев.
    4. В отличие от мелких, большие локоны можно уложить в любую прическу, заплетая косы.
    5. Если есть склонность к аллергии, то перед процедурой нужно сделать тест, для этого средство для завивки наносится на сгиб локтя или область за ухом.
    6. Обновлять прическу можно не часто, так как волосы станут сухими, их будет сложно расчесывать, и локоны по длине будут обламываться.
    7. Перед завивкой желательно посоветоваться с хорошим мастером. Даже если у него нет средств, чтобы завить его, он может подобрать вид композиции по состоянию волос.
    8. Не рекомендуется химическая завивка во время менструации, лечения антибиотиками и особенно во время беременности.
    9. От окрашивания волос до химии нужно выдержать не менее 2 недель.
    10. Для восстановления здоровья необходимо делать увлажняющие и регенерирующие маски.
    11. Слишком сухие концы нужно регулярно обрезать, они не заживут.
    12. После химии смело придавать яркость волосам без окрашивания, можно использовать тоники.
    13. Лучше расчесывать локоны гребешком с редкими деревянными зубцами.

    Если следовать этим простым советам, то крупные локоны будут мягкими и красивыми.

    Виды завивки


    1. Acidic С его помощью можно сделать мягкие и естественные локоны.Средство проникает в волосы, не разрушая верхний слой. Подходит для жестких вьющихся волос, т. К. На мягких волосах может не быть эффекта. А на жесткие и прямые локоны держится не больше месяца.
    2. Щелочной. Самый дешевый и доступный. Сильно портит волосы. Можно делать большие и мелкие локоны. Завивка держится долго, локоны упругие.
    3. Нейтральный. Эта завивка представляет собой нечто среднее между щелочной и кислой. Локон выглядит естественным, не очень упругим. Держит форму около 3-4 месяцев.
    4. Аминокислота. В составы добавляются полезные для волос вещества, химическая укладка становится менее вредной, но результат не такой стабильный.
    5. Шелк. Обязательным компонентом в составе являются протеины шелка. Эта химическая завивка делает каждый локон гладким и шелковистым. Единственный минус - ломкость, локоны продержатся не более 2 месяцев.
    6. Японский Этот тип подходит для сухих и поврежденных волос. Входящие в состав липиды и протеины увлажняют локоны и ухаживают за ними.Локоны мягкие и естественные.

    Помимо используемого состава, результат и качество локонов зависит от техники наматывания и диаметра бигуди. Можно наматывать внахлест, по спирали или просто катать. Вы также можете заплести пряди в локоны перед завивкой. Существуют приемы, в которых сочетаются бигуди разного диаметра или локоны, накрученные по-разному.

    Технологии регулярно меняются и дополняются. Их подбирают в зависимости от исходного состояния прически и особенностей внешности.Так, например, для круглого лица попробуйте сделать вертикальный локон. А удлиненная форма получается более упругой и пышной локон при прикорневом объеме.

    Керлинг в домашних условиях

    В домашних условиях локоны можно сделать на бигуди, используя химический состав, самый простой старинный и традиционный «Локон». Но в специализированном магазине можно купить более щадящее, бережнее ухаживающее за волосами.


    Следует заранее подготовить:

    • Чаша для композиции
    • Кисть
    • Расческа
    • Колпачок утепляющий
    • Перчатки
    • Полотенца
    • Уксус
    • Фиксатор
    • Большие шпульки



    Техника Пермь в домашних условиях:

    1. Волосы разделены на переднюю часть и 2 боковые.
    2. Кожа лица и ушей смазывается любым жирным кремом, отлично подойдет детский.
    3. Пряди наматываются на большие бигуди.
    4. Каждый змеевик быстро смачивается средством, которое обильно пропитывается.
    5. На голову надевается мешок, затем согревающая шапочка.
    6. Спустя время бигуди, не снимая, смывают водой.
    7. Фиксирующий агент взбивается в плотную пену и наносится на бигуди.
    8. Выдерживается 5 минут.
    9. Бигуди снимаются, а пряди снова обрабатываются фиксатором. Выдержали еще 5 минут.
    10. Локоны промываем водой с добавлением уксуса.

    Это примерная технология, чтобы сделать большие локоны в домашних условиях. В зависимости от используемых средств он может незначительно отличаться.

    Что должно быть в составе средств

    Покупая средство для завивки в домашних условиях, нужно знать, из чего оно должно состоять.

    1. Аминокислоты, кератин.Эти компоненты защищают волосы и облегчают нанесение.
    2. Бромат калия или натрия. Они наладчики.
    3. Изопропиловый спирт. Он служит для ускорения завивки локонов, но губительно влияет на волосы.
    4. Ароматизатор Устраняет неприятный запах.
    5. Мочевина. Он служит для смягчения структуры волос.

    Все средства делятся на кислотные и нейтральные. Сейчас в продаже можно найти специальные гели и пенки для долговременной укладки. Они готовы к употреблению и больше не нужно рассчитывать пропорции для приготовления составов.В отличие от классического щелочного перманента, они меньше повреждают волосы.

    Если все же делать химическую завивку страшно, то как вариант - накручивая на большие бигуди. Правильно подобрав средство для укладки, локоны продержатся до мытья головы. Кроме того, в домашних условиях можно поэкспериментировать и индивидуально подобрать технику закручивания прядей.

    Вьющиеся локоны подходят к любым формам лица, зрительно освежают образ и придают ему романтичности. Биозавивка волос позволяет за одну процедуру добиться стойкого эффекта кудрявых прядей и забыть даже на полгода о трудностях укладки.

    Biowave - Современный метод завивки волос, не использующий агрессивные химические компоненты. Процедура проводится с использованием специальных составов, в которых около 60% компонентов натуральные. Конечно, нельзя сказать, что средство для биологической завивки состоит полностью из натуральных компонентов, но процент синтетических добавок в них намного меньше, чем в химической завивке.

    Основным ингредиентом почти всех средств для завивки является цистеамин.Это синтетическая кислота, похожая на цистеин. Необходимо удалить лишнюю серу и улучшить их структуру. Именно это соединение придает неприятный запах локонам после процедуры, но вместе с тем способствует улучшению их состояния.

    Преимущества биозавивки:

    • Относительная безопасность Конечно, эту процедуру нельзя назвать полностью безвредной, но волосы от завивки биологически активными компонентами страдают меньше, чем от обычной укладки с завивкой или утюжком;
    • Локоны можно распрямить.Если вам надоело все время ходить с одной укладкой, то локоны можно просто выровнять выпрямителем. В отличие от химической завивки, после которой пряди похожи на паклю, биологические воздействия не повреждают конструкцию. После следующей стирки скрученная форма вернется;
    • Любое средство для процедуры несколько подсушивает кожу у корней. Для обладательниц сухих волос - это минус, а для девушек с комбинированными или жирными локонами - весомый плюс. За счет этого они станут намного менее грязными, жирные корни даже через 5 дней станут практически незаметными;
    • Продолжительный эффект.Если обеспечить правильный уход, то результат завивки порадует не менее полугода. Далее по мере роста прядей можно будет повторять процедуру;
    • После такого завитка можно красить корни и длину. После химии вообще не рекомендуется воздействовать на пряди, особенно в прикорневую зону. Но чем же тогда девушки регулярно подкрашивают отрастающие корни? Биологический состав средства для химической завивки решил эту проблему.

    Несмотря на все достоинства, у процедуры есть и недостатки.

    Недостатки биозавивки:

    • Несмотря на натуральность, наносит вред. Процедура подходит не всем, некоторые девушки говорят, что даже при правильном уходе у них начинается массовое рассечение кончиков и выпадение прядей;
    • Единственный способ полностью избавиться от эффекта биозавивки - стричь волосы. Меры радикальные, но эффективные. Полностью выпрямить поврежденные волосы даже через год после завивки нельзя. Если растущие колтуны устали, просто разрежьте их;
    • Эта технология портит структуру волос.Они могут стать пористыми или начать сильно давить;
    • Процедура не рекомендуется при беременности из-за вероятности нанесения вреда плоду;
    • Через несколько недель после завивки с головы появится неприятный запах (мокрая шерсть, носки - как кажется). Убрать его практически невозможно. Не помогают ни профессиональные шампуни, ни отвары розмарина. Просто нужно какое-то время, чтобы полностью вымыть цистеамин из локонов;
    • Порка требует особого восстановления.Без него через месяц регулярной сушки феном они станут похожи на комок распущенных волос;
    • Процедура имеет противопоказания. Биологическая волна не проводится при грудном вскармливании, наличии воспалительных процессов в организме, любых заболеваниях волосистой части головы, открытых ранах или царапинах в местах лечения.

    Типы биозавивки

    В салонах красоты используются различные инструменты для биозавивки. По своему активному составу процедура классифицируется.

    1. Шелковая химическая завивка . В состав средств входят протеины шелка, которые возвращают блеск и эластичность. Процедура отличается мягкостью, поэтому рекомендуется девушкам с цветными или выбеленными прядями. Также используется для коррекции химической волны;
    2. Японская биозавивка Включает не только незаменимые аминокислоты, но и протеиновые коктейли. Чаще всего это смесь коллагена с искусственными ингредиентами. Его используют, если пряди толстые и длинные, потому что он известен своей «жесткостью».«Эффект сохраняется не менее 5 месяцев, после чего требуется коррекция;
    3. Итальянская биозавивка Mossa (Мох) , как и кислота, позволяет получить красивые упругие локоны прочной фиксации. В основном он применяется на коротких волосах, но этот прием подходит и для стрижек каскад и каскад. В результате получаются мелкие локоны, похожие на африканские локоны.

    Также химическая завивка классифицируется по длине, на которую она выполняется.

    Легкие крупные локоны или роскошные голливудские кудри способны придать шик любому образу.Такая дизайнерская прическа идеально подходит для коротких волос со стрижкой каре и обладательниц гривы до пояса. Основное отличие этой методики от других - использование белковых смесей средней фиксации японского производства.



    Как происходит биозавивка на больших локонах:

    haird Видео

    Полученные волнистые пряди первые три дня нельзя стирать, заплетать в косы и перетягивать резиной.Это необходимо для того, чтобы смесь прекратила свое действие.

    Биозавивка на короткие волосы

    Если вы не хотите становиться обладательницей крупных локонов, на коротких волосах можно сделать маленькие вьющиеся волосы. Они намного дольше держатся на голове и помогают сделать «жидкие» волосы более объемными. Для этого используют специальные папилотки и средства прочной фиксации, в основном итальянского производства.



    Как проходит биозавивка на короткие волосы много На челку:

    9002 Биозавивка на короткие и средние волосы Скажем, биозавивка прямых длинных волос - самая сложная и долгая из всех вышеперечисленных процедур.Из-за выраженности их корневая зона находится слишком близко к коже головы, что сказывается на объеме волос. Даже если использовать средства сильной фиксации, локоны быстро опадают.


    Чтобы этого не случилось, специалисты рекомендуют работать с японскими поездами на длинных прядях. Они нежно воздействуют на волосы, закручивая их в нужную форму, но не перегружая синтетическими веществами. В дальнейшем при естественном сглаживании переход между скрученной частью и отросшим становится не так очевиден.



    Вся технология завивки похожа на большие и мелкие локоны на коротких и средних волосах.

    Но есть секретов, которыми пользуются только мастера. профессиональные салоны красоты:

    • Осветленные и окрашенные волосы лучше поддаются завивке, но им нужно мягкое воздействие. Для оптимального эффекта используются белковые смеси или продукты с добавками водорослей;
    • Процедура не проводится на наросших локонах, так как реакция смолы или используемого клея под воздействием активатора непредсказуема.Клей может отвалиться или, наоборот, стать несмываемым;
    • Для длинных прядей лучше всего использовать бигуди диаметром 1,5 и более. Так локоны будут максимально естественными.

    Видео: Как сделать натуральные локоны (биозавивка на фасоль)

    Как сделать биозавивку в домашних условиях

    Не секрет, что эта процедура имеет высокую цену. За волосы на плечах придется заплатить не менее 50 долларов. Но если вы купите набор для завивки и проведете сеанс самостоятельно, то вложения будут минимальными.

    Пошаговая инструкция, как сделать биозавивку в домашних условиях своими руками:

    Необходимые средства

    Для работы вам понадобятся наборы для биозавивки волос, шампунь, бальзам или маска для восстановления порядок, а также масло для кончиков. Чтобы результат радовал вас долгое время, а волосы были минимально пересушенными, важно правильно подобрать средство для завивки. Рассмотрим список самых популярных:

    Bio Permanent Niagara от Estel (Ниагара Эстель) - полусинтетический состав, обладающий множеством преимуществ.Подойдет трудно завитым волосам, непослушным прядям, обладательницам густых волос. Относится к продуктам сильной фиксации, но может применяться, как на короткие, так и на длинные локоны. Действующее вещество - цистеамин и витамин B5.


    Биозавивка - эффективный продукт с умеренной степенью фиксации. Фиксатор здесь также насыщен цистеамином, но он обогащен водорослями и минеральными соединениями. Подходит для завивки окрашенных прядей.


    - особой любовью потребителей структура не пользуется.Несмотря на название, в продукте присутствуют очень вредные для волос агрессивные соединения (производные аммиака).


    Как долго действует биозавивка?

    Полезные советы:

    • Быстро восстановить волосы не получится, поэтому процесс регенерации осуществляется постепенно. В первую неделю нельзя делать маски глубокого действия, но можно добавлять небольшое количество силиконовых смесей во вторую неделю при мытье локонов;
    • Старайтесь мыть волосы только в ванной - при вертикальной стирке кулинария выдергивается и им будет сложнее вернуться в форму при сушке;
    • Конечно, самое сложное - это расчесывать локоны.Чтобы облегчить этот процесс, используйте расческу с широко расставленными зубцами и бальзам. Также можно раз в неделю смывать бесцветную хну;
    • Используйте специальные средства для поврежденных или окрашенных волос. Их много в линиях Schwarzkopf, Garnier и других;
    • Не позволяйте локонам высыхать самостоятельно. При сушке диффузором приподнимите локоны как бы - тогда они будут упругими и объемными, как пружины.

    По прошествии 6 месяцев окончательно восстановить локоны поможет ламинация или профессиональная кератиновая маска.Эти меры окончательно выравнивают пряди. Для коррекции можно завить в домашних условиях бигуди, повторить процедуру или сделать резьбу.

    Фото до и после

    Обладательницам вьющихся волос очень удобно в повседневной жизни: не нужно тратить много времени на укладку или бояться влажного воздуха. К тому же вьющиеся локоны выглядят скорее женственнее, чем идеально гладкие. Чтобы убедиться - достаточно посмотреть фото до и после биозавивки.



    Кудри - идеальный вариант для обладательниц тонких и лишенных объема волос.Такая прическа создает впечатление густоты и силы локонов, придает облику романтизма и женственности. Для создания определенных локонов специалисты используют разные виды химической завивки.

    Изначально для создания этой укладки использовалась тиогликолевая или меркаптоуксусная кислота. Это универсальные вещества, которые в зависимости от дополнительных компонентов способствуют окрашиванию волос, их завивке и даже входят в состав некоторых кремов-депиляторов. Принцип технологии основан на способности кислот глубоко проникать в структуру прядей.


    Парикмахеры используют кислотную химическую завивку только в исключительных случаях. Например, если волосы тяжелые и густые. Просто никакой другой метод здесь не будет достаточно эффективным. При работе с мягкими составами локоны держатся не более 1,5 месяцев.

    Эта технология структурирования прядей имеет множество недостатков. Техника отличается резким запахом и жестким воздействием. Из-за большого количества побочных эффектов и противопоказаний в настоящее время его проводят с использованием сбалансированных кислотных смесей.В отличие от подавляющего большинства методов химической завивки, не оказывает губительного воздействия на локоны.

    Типы методов:

    • Эндотермический . Для реакции голова нагревается внешними источниками тепла. Это может быть фен или специальная подставка. Этот метод был очень распространен в 70-х и 80-х годах в Советском Союзе.
    • Экзотермический . Здесь нагрев осуществляется за счет протекания самой реакции. Метод относится к новым технологиям.Он более щадящий и может использоваться для завивки окрашенных или мелированных волос.

    Кислотно-химическая стружка проводится по стандартной схеме. Сначала на локоны наносится смягчающий состав, который несколько «растворяет» верхний роговой слой волос. Затем на прядь нанесите агрессивную кислоту, зафиксировав кудряшку в определенном положении. Для накрутки прически использовались аккуратные пластиковые пилочки. Редко - резинки, которыми завивались локоны.

    Щелочная химическая волна

    Впервые этот метод был предложен во второй половине 20 века учеными и по совместительству парикмахерами-стилистами Ральфом Эвансом и Эвереттом МакДонахью.В качестве активатора и закрепителя локонов используется довольно агрессивная смесь аммония и гликолевой кислоты.




    Как щелочная химическая завивка с видео:

    • Для нее используются не обычные папиллы с твердой основой, а своеобразные тампоны. Их пропитывают щелочным составом, после чего на них накручивают пряди волос.
    • Эту смесь выдерживают до 40 минут и смывают чистой водой без шампуня.В отличие от современных методик, повторное нанесение фиксатора не требуется.
    • Полученные локоны слегка расправляются и укладка считается завершенной.

    Это чрезвычайно эффективная, но опасная процедура. После него локоны становятся ломкими, тусклыми. Щелочь обладает неприятным свойством разрушать стержень волоса, что также влечет за собой увеличение ломкости фолликулов. Чуть позже, в 80-х годах прошлого века, было предложено использовать сбалансированные составы кислот. Сейчас щелочь используется очень редко, потому что считается опасной.

    Практически все типы химической завивки используют агрессивные кислоты в качестве устойчивых соединений. Они съедают верхний слой волос. В результате пряди становятся безжизненными и ломкими. Напротив, нейтральная химическая завивка проводится с веществами с низким pH.


    В качестве дополнительных компонентов в состав средства для такой укладки входит аллантоин. Это продукт окисления мочевины, полученный при переработке мочевины.Его главное свойство - смягчение рогового слоя и ускорение регенерации тканей. Вещество помогает восстановить пряди после кислоты и нормализовать работу сальных желез.

    Отзывы утверждают, что это альтернатива перечисленным кислотным вариантам. Это самый мягкий способ из всех видов химической завивки, как сделать себе стойкие локоны на средние волосы. Часто биозавивка состоит всего из двух компонентов - фиксатора и восстанавливающего вещества. Цистеамин и гликолевая кислота используются в качестве компонента для моделирования.Это полностью натуральные ингредиенты, присутствующие в организме человека.



    В качестве дополнительных продуктов вы можете найти кератин или морской комплекс, витамины, аминокислоты и даже масла в составе фиксаторов. Главное преимущество техники перед всеми остальными - возможность реконструировать волосы, не оказывая на них негативного воздействия.

    Шелк

    Деликатный вариант химической завивки волос с применением безаммиачных препаратов.Подходит обладательницам длинных и средне тонких волос. Особенностью техники является наличие в активном составе натуральных протеинов шелка. Для обогащения волос дополнительно используется коллаген и рафиноза. Рафиноза - это разновидность резервных углеводов, она способна удерживать влагу и укреплять сердцевину локона.



    Самым известным средством для этой установки считается комплекс ОМС. Нет веществ, травмирующих структуру волос.Для этой сложной завивки используется квинтэссенция, состоящая из лосьонов для завивки, активатора и нейтрализатора. В отличие от других подобных средств, после применения шелковой химической завивки не остается неприятного запаха от волос.

    ит легкая химия. Она не похожа ни на какие другие виды химической завивки, потому что, по сути, является укладкой. Есть разные изделия для резьбы: Wella, Londa, Schwarzkof и Cutrin. Перечисленные наборы не содержат агрессивной гликолевой кислоты, вместо этого они обогащены карнитином и витаминными комплексами.



    Метод долговременной укладки имеет как достоинства, так и недостатки. К достоинствам техники можно отнести универсальность (делается на короткие, длинные и средние волосы), долговечность, возможность менять прическу. Из минусов: локоны очень сухие, становятся ломкими, их невозможно сушить без диффузора и средств для укладки.

    Безщелочная химическая завивка для мелирования, омбре и осветленных волос. В качестве активных компонентов он использует цистеин, матрикс и бетаин.Все это - натуральные вещества, входящие в состав ороговевших частиц человеческого тела, в том числе волос.

    • Цистеин . Аминокислота с высоким содержанием серы. Считается мощным антиоксидантом, защищает организм от воздействия радиации;
    • Бетаин . Триметиламиноуксусная кислота. Для него характерно множество положительных воздействий на ткани организма. Обладает увлажняющим, защищающим, смягчающим и укрепляющим действием.
    • Матрица .Компонент волос, отвечающий за рост и развитие фолликулов. В косметике он используется как молекулярный компонент. Придает прядям гладкости и прочности, благотворно влияет на луковицы.

    В результате такой химической завивки получаются идеальные крупные локоны. Благодаря большому количеству увлажняющих компонентов такие локоны яркие, блестящие, упругие. Но, к сожалению, такой эффект после завивки сохраняется всего 1 месяц. Для его дальнейшего усиления требуется постоянное использование кондиционеров и бальзамов.


    На протяжении веков у представительниц прекрасного пола существует один закон, если волосы прямые, чтобы завить их. Считается, что вьющиеся локоны делают образ девушки легким, романтичным и женственным. Однако не все волосы легко завить бигуди и завивать, поэтому выход из этой ситуации - химическая завивка. Об этом и поговорим. Химическая завивка - это модификация структуры локона, придающая ему красивый локон. На сегодняшний день принцип работы не претерпел изменений, чего нельзя сказать о средствах, используемых для выполнения химической завивки.Благодаря разнообразным добавкам смягчающих компонентов современная химическая завивка бережно воздействует на волосы и кожу головы. Этот метод позволяет получить те крупные локоны, волны, спирали, о которых вы всегда мечтали, и в итоге обрести новый воздушный образ.

    Внимание! До сих пор нет возможности получить красивые локоны, не причинив себе вреда. Даже если вы используете самые современные инструменты в лучших салонах мира.

    Как проходит процедура

    Химическая завивка проводится на чистой голове, так как жир не позволяет веществу проникать в стержень волоса.Однако, если они слабые, их следует вымыть за несколько дней до процедуры. Затем проверьте, нет ли на коже головы прыщей или ссадин. Обязательно проверьте кожу на предмет аллергической реакции на препарат. Для проверки нужно немного причесать бигуди за ухом и посмотреть реакцию через четверть часа. В случае покраснения кожи от этого следует отказаться. Также не делайте эту процедуру, если ваши пряди начали легко рваться через десять минут, после того как вы нанесли на них раствор.

    Если вы прошли все тесты, и все оказалось в порядке, то для получения желаемого результата, в первую очередь, нужно нанести на волосы специальную химию.В этом состоянии они будут принимать любую заданную форму, поэтому мы берем определенную форму шпульки или бигуди для волос и наматываем на них наши локоны. Пряди не нужно сильно наматывать, а вот кончики накручивать нужно аккуратнее. Далее нужно смыть вещество с головы, причем делать это, не снимая шпульку, под проточной водой. Для закрепления результата необходимо обработать волосы гидропериодом. Теперь аккуратно снимаем шпульки и еще раз накладываем фиксатор, ведь именно благодаря правильной фиксации мы получаем желаемый результат.После этого снова вымойте волосы, но без шампуня и ополосните раствором уксуса. После их высыхания наносим бальзам-ополаскиватель и в дальнейшем проводим необходимые специальные процедуры по уходу за волосами.

    Немного о бигуди и шпульках

    Правильный размер коклюшек играет немаловажную роль в будущей прическе. Их размер зависит от желаемого конечного результата прически. Если у вас короткие волосы, то у вас пойдут небольшие локоны, которые увеличат их объем, полученные с помощью бигуди небольшого диаметра.Волосы чуть длиннее таких бигуди обеспечат очаровательные локоны. Для длинных волос лучше подбирать коклюшки большого размера. Благодаря им вы получите роскошные волнистые локоны.

    Закручивая локоны на коклюшках, помните, что ширина пряди должна примерно соответствовать размеру пряди, иначе локоны могут получиться неодинаковыми. Намотанные пряди толщиной не более 5 мм необходимо надежно закрепить резинкой, лучше восьмой, чтобы не развалиться.Таким образом, продолжайте накручивать все волосы.

    Направление последовательности завивки напрямую зависит от размера ваших волос. Если вы хотите сделать химию для длинных волос, то наматывать коклюшки нужно начинать с затылка и переходить к шее, а затем, наоборот, к лобной области. Если волосы короткие, то в этом случае нужно начинать с лица и переходить к шее. В этом случае шпульки или бигуди необходимо расположить горизонтально.

    Виды завивки

    Виды завивки следующие:

    Кислый;

    Щелочной;

    нейтральный;

    Аминокислота.

    Кислый вид обеспечивает прочную фиксацию и подходит для волос любого типа. Однако такая процедура вызывает сильные повреждения, и чтобы все восстановить, необходимо провести специальные процедуры.

    Самый распространенный метод завивки - щелочной. Этот метод более мягко воздействует на ваши локоны. Ваши волосы станут более естественными и здоровыми. Однако результат этого метода может наступить в короткие сроки и подходит далеко не всем.

    Нейтральная завивка - самая щадящая, однако повреждений все же не избежать.

    Аминокислотная форма - инновация для слабых и поврежденных волос. Результат от такой процедуры не такой долгий по сравнению с другими, однако это лучший вариант для слабых волос. Поскольку вещества, входящие в состав продукта, а именно аминокислоты и белок, оказывают на волосы питательное действие.

    Как и все в этом мире, у химии есть свои плюсы и минусы, поэтому, прежде чем принять решение, нужно хорошо взвесить все за и против.

    Плюсы:

    Получатся шикарные, ярко выраженные локоны;

    Результат вам дается надолго;

    Процедура обойдется вам недорого.

    Минусы:

    Ваши волосы могут выглядеть как пучок соломы.

    Даже обладательницам самых здоровых волос и кожи повторную химическую завивку можно сделать не ранее, чем через год.



    Биозавивка для волос

    Один из новых щадящих способов - биозавивка. В состав для выполнения химической завивки входят серизин и кератин. Такое сочетание помогает добиться определенной мягкости и сияния шикарных локонов, при этом придавая им естественный вид.Биозавивка не оказывает такого негативного воздействия, как другие химические завивки.

    Биозавивка имеет следующие преимущества:

    Кожа головы не портится;

    Волосы остаются такими же блестящими;

    Полученный результат сохраняется надолго;

    Структура волос и их цвет остаются неизменными;

    С незаметно выраженной линией отрастания волос.

    Резьба

    Еще один щадящий способ завивки волос - это метод, называемый «карвинг».С его помощью можно смоделировать желаемый объем и пушистые локоны, которые легко поддаются любой укладке.

    Другими словами, карвингом называют легкую химию, после чего полученный эффект сохраняется до двух месяцев, особенно если волосы часто подвергаются окрашиванию или мелированию. Эта процедура достаточно дорогая, но при этом не портит кожу и волосы, что позволяет повторить ее через несколько месяцев.

    Эта процедура будет полезна даже тем, у кого жирная кожа головы, ведь карвинг немного сушит кожу и волосы.

    Обладательницы длинных, густых и никогда не крашенных волос, решившие сделать резьбу, просто выбрасывают деньги на ветер. Ведь химия будет немного видна или не видна совсем.

    Ошибки мастера

    Часто бывает, что ваши волосы страдают от глупых ошибок мастеров, которые делают вам химию. Наиболее частыми ошибками мастеров являются:

    Избыточное использование химических средств, приводящее к раздражению кожи головы и шеи;

    Волосы скручиваются и закрепляются резиночками слишком туго, в результате чего они легко становятся ломкими;

    Экономия количества коклюшек за счет наматывания толстых прядей и при этом получение полусвитого подобия локонов;

    Использование неподходящих средств, малое время фиксации, использование шпулек чрезмерно большого размера, образующих слабые локоны;

    Передержка средства во времени сделает ваши волосы совершенно не привлекательными;

    Использование металлической посуды в работе может привести к химической реакции, в конечном итоге получению металлического налета на ваших локонах.

    Кроме того, химическую завивку волос делать не рекомендуется:

    Во время беременности;

    Натощак;

    В критические дни;

    При высокой температуре;

    С низким или высоким давлением;

    С недавним окрашиванием;

    При наличии слабого организма;

    При приеме антибиотиков или гормональных препаратов.



    Как сделать химическую завивку в домашних условиях

    Сделать завивку в домашних условиях несложно, однако помощник вам обязательно понадобится.Кроме того, вам не помешают следующие аксессуары:

    Коклушки или бигуди нужного диаметра, а также резинки для фиксации около семидесяти штук;

    Зажимы для защипывания мешающих локонов;

    Расческа и губки;

    Перчатки резиновые, стакан для правильного измерения количества средства, пара сосудов;

    Пара полотенец, вода для ополаскивания и специальные средства для химической завивки.

    Все остальное, в том числе и процесс проведения химической завивки в домашних условиях, ничем не отличается от описанной выше салонной процедуры.

    Если ваши волосы уже прошли химическую обработку, но вы хотите придать полный объем у корней, то вам следует обратиться к радикальной химии.

    Уход за волосами после химической завивки

    Независимо от того, насколько хорошо вам сделана химическая завивка, ваши волосы нуждаются в правильном уходе. Для начала нужно произвести замену привычных средств для мытья головы на специальные средства по уходу за волосами с химической завивкой. Советую заинтересоваться средствами на основе пшеничного и пальмового масла.Кончики волос следует стричь как можно чаще.

    Совет! Для идеальной укладки следует использовать фен с диффузором, а также средства с пометкой «для вьющихся волос». Это обеспечит вам красивые локоны и шикарный естественный объем.

    Химическая завивка - процесс превращения прямых локонов в живые, пушистые локоны. С его помощью создаются большие волны или мелкие локоны. Единственный недостаток прически - сильно портятся волосы.

    Карл Несслер изобрел волосы в 1906 году, проводя первый эксперимент на своей жене. С тех пор получить роскошные кудрявые локоны желает большое количество женщин.

    На примере фото на средние волосы мы раскроем секрет, как получить завивку волос крупными локонами. В этом нам пригодятся популярные продукты Alfaparf Milano, Meisheng, Estelle, Vella.

    Среди преимуществ химической намотки можно выделить следующие:

    • четкие локоны, локоны;
    • долго смотрится красиво;
    • низкая стоимость.

    Единственный недостаток - из-за воздействия лекарств ухудшается здоровье и состояние стрижки. Волосы становятся ломкими и сухими.

    Виды химической завивки

    Завивка на средние волосы с крупными локонами показана на фото. Он делится на виды в соответствии с составом элементов. Среди современных видов следующие:

    1. Кислый Специальный препарат проникает в структуру шевелюры, но не обнажает чешуйки.Результат - плотные локоны. Запрещается при наличии тонких рыхлых прядей. Противопоказаны сухие и ломкие локоны. Сами локоны быстро растянутся и потеряют форму. После химии при сильном повреждении волос придется сделать короткую стрижку, нанести современные медицинские маски. Действие кислотной химической завивки с крупными локонами на средние волосы, например, фото держится 1 месяц. Подходит при регулярном окрашивании.
    2. Щелочной. Эффект сохраняется до 3 месяцев. Локоны выглядят естественно, упруго.Препарат проникает в пряди и открывает чешуйки, но действует мягче, чем кислотная химическая завивка. Не рекомендуется для жестких густых волос.
    3. Нейтральный. Обладает смягчающим действием и подходит для всех типов волос. Получаются красивые, упругие локоны, которые держатся от 3 до 6 месяцев.
    4. Аминокислота. В веществах содержатся белки и аминокислоты, питающие пряди. Не подходит для длинных, густых и жестких волос, так как под собственным весом локоны быстро становятся гладкими.
    5. Биозавивка В составе отсутствуют пергидрол, аммиак, тиогликолевая кислота.Черный химикат для завивки придает локонам здоровый блеск и естественность. Обладает высокой прочностью.
    6. Кроме того, есть японская, американская пермь. В зависимости от используемых средств может быть временным или постоянным.

    Меры предосторожности перед использованием

    1. Редкие пряди станут очень сухими, начнут путаться, выпадать. Вам нужно будет постоянно пользоваться кондиционерами, бальзамами, спреями.
    2. Иногда после процедуры появляется неприятный запах, который держится неделю.
    3. Необходимо пить витамины, делать питательные маски, наносить лосьоны.
    4. Любая химическая завивка вредна для волос. Особенно страдает кожа у корней и кончиков.
    5. Высушите голову сразу после мытья.
    6. Нельзя мыть голову первый день.

    Противопоказания:

    1. Склонность к аллергии.
    2. Распущенные или поврежденные волосы.
    3. Период после обесцвечивания, ламинации. Пряди станут излишне ломкими.
    4. Лучше избегать химии блондинкам.
    5. Период менструации, первые дни в конце.
    6. Беременность.
    7. Прием сильнодействующих препаратов.
    8. Инфекционные и простудные заболевания.
    9. Окрашивание натуральными красителями - басма, хна.
    10. Осадки после химии указывают на повреждение лампочек.



    Уход после завивки

    После косметической процедуры волосы нуждаются в постоянном уходе.Таким образом, негативное влияние химии будет сведено к минимуму. Предлагаем простые советы:

    1. Для мытья головы вам понадобится специальный шампунь, также подходящий для ослабленных и поврежденных локонов. После мытья ополосните волосы хлебным настоем. Для этого 300 г ржаного хлеба залить кипятком, настаивать 5 часов. Также используйте настои ромашки, хмеля, крапивы.
    2. Обязательно после увлажнения смочите пряди масками с коллагеном, протеинами шелка, пантенолом, кератином. Подойдут репейное, миндальное, персиковое масла, предварительно слегка подогретые.
    3. Регулярно корректируйте стрижку, удаляйте сухие кончики.
    4. Обратите особое внимание на прическу зимой.
    Делаем локоны в домашних условиях

    Для домашней плойки подойдет классический вариант, где толщина локонов 2-20 мм. Заранее приготовьте большие и маленькие бигуди. Крупные создадут волнистые локоны, они легко накручиваются, но чем крупнее локоны, тем быстрее они выравниваются.
    Чтобы усилить действие, следуйте процедуре лунного календаря.


    Секреты того, как сделать химическую завивку плюс в домашних условиях, пошагово по примеру продукции Schwarzkopf, представлены ниже.

    1. Тщательно вымойте голову 2 раза, так как жировая пленка предотвращает воздействие химических компонентов. Если прядки ослаблены, наоборот, не мойте волосы 2 дня, чтобы не навредить коже химическими компонентами.
    2. Разделите волосы на 2 зоны, закрепите зажимами. Крутить. Ширина локонов не должна превышать ширину бигуди. Не забудьте купить специальные спиральные шпульки.
    3. Если прядки короткие, предварительно смочите их химическим составом, затем накрутите во влажном состоянии.Нанесите состав дважды. Если локоны средние или более длинные, нанесите состав непрямым способом: накрутите влажные пряди, а сверху нанесите смесь. На длинной прическе сначала смочите в составе кончики, затем обработайте по всей длине.
    4. При наматывании бигуди обращайте особое внимание на концы. Закрепите их плотно, не перетягивайте основную часть. Толстая подходит для висков, шеи. Тонкий - для остальных частей. По такому принципу делаются афрокудри - новинка сезона.
    5. Нанести состав быстро и равномерно. Сначала слегка прикрываем локоны, второй раз интенсивно.
    6. В конце головной убор. Держите 20-40 минут.
    7. Как только степень химической завивки сохранится, смойте средство, не разворачивая бигуди. Смывать состав не менее 6-8 минут.
    8. Нанесите нейтрализатор, например, гидропонный. Поставляется с инструментом.
    9. Снимите шпульки, нанесите фиксатор. Через 6 минут смойте состав без шампуня, тщательно промойте голову раствором уксуса, альтернатива - лимонной кислотой.
    10. Волосы влажные, сушат в холодном режиме.

    Как расправить пряди после завивки? Восстановить красоту локонов можно с помощью кератинового выпрямления или отказаться от процедуры и избавиться от локонов естественным путем.


    Химическая завивка волос в домашних условиях по пошаговой инструкции легко осуществляется без помощи специалиста. Стоит ли самому делать, решайте по отзывам. Смотреть видео.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *